Email Alert | RSS

Journal of Peking University (Health Sciences) ›› 2026, Vol. 58 ›› Issue (3): 616-623. doi: 10.19723/j.issn.1671-167X.2026.03.023

Previous Articles     Next Articles

Effect of LncRNA DANCR on the immune microenvironment of glioma cells by regulating the miR-656/BMPR1A axis

Ouyang WANG, Penglei ZHU, Jie LIN, Hao WU*()   

  1. Department of Neurosurgery, Wenzhou People' s Hospital, Wenzhou 325006, Zhejiang, China
  • Received:2024-04-18 Online:2026-06-18 Published:2026-03-13
  • Contact: Hao WU
  • Supported by:
    the Wenzhou Science and Technology Bureau in 2023(Y2023462)

RICH HTML

   

PDF (PC)

Abstract:

Objective: To investigate the effect of long non-coding RNA (LncRNA) differentiation antagonizing non-protein coding RNA (DANCR) on the immune microenvironment of glioma cells by regulating the miR-656/bone morphogenetic protein receptor type 1A (BMPR1A) axis. Methods: The expression levels of DANCR, miR-656 and BMPR1A in glioma cells were detected by quantitative real-time polymerase chain reaction (qRT-PCR). The U87 cells were transfected or co-transfected to form the following groups: sh-DANCR (transfected with sh-DANCR), overexpression (pcDNA 3.1) DANCR (transfected with pcDNA 3.1 DANCR), NC sh (transfected with negative control sh), pcDNA 3.1 (transfected with pcDNA 3.1 vector), sh-DANCR + miR-656 inhibitor (co-transfected with sh-DANCR and miR-656 inhibitor), sh-DANCR + NC inhibitor (co-transfected with sh-DANCR and NC inhibitor), sh-DANCR + pcDNA 3.1 BMPR1A (co-transfected with sh-DANCR and pcDNA 3.1 BMPR1A), and sh-DANCR + pcDNA 3.1 (co-transfected with sh-DANCR and pcDNA 3.1 BMPR1A). The untreated U87 cells were used as the blank group. The proliferation of U87 cells was detected by CCK-8; invasion and migration were detected by Transwell assay; apoptosis was detected by flow cytometry; the expression of DANCR, miR-656, and BMPR1A mRNA in cells was detected by qRT-PCR; the targeting relationship between DANCR and miR-656 was verified by dual-luciferase; and BMPR1A and immune escape factors [programmed death receptor 1 (PD-1) and programmed death-ligand 1 (PD-L1)] were detected by Western blot. Results: The mRNA expressions of DANCR and BMPR1A in U87, A172, LN229 and U251 cells were significantly increased, while the expression of miR-656 was significantly decreased compared with those in NHA cells (P < 0.05). Compared with the blank group and sh-DANCR group, the proliferation rate, invasion, migration number, DANCR, BMPR1A mRNA, BMPR1A, PD-1, PD-L1 expression of U87 cells in the sh-DANCR group were obviously reduced, while the apoptosis rate and miR-656 expression were obviously increased (P < 0.05). Compared with the pcDNA 3.1 group, the proliferation rate, invasion, migration number, DANCR, BMPR1A mRNA, BMPR1A, PD-1, and PD-L1 expression of U87 cells in the pcDNA 3.1 DANCR group were obviously increased, while the apoptosis rate and miR-656 expression were obviously reduced (P < 0.05). Compared with the sh-DANCR +NC inhibitor group, the proliferation rate, invasion, migration number, BMPR1A mRNA, BMPR1A, PD-1, and PD-L1 expression of U87 cells in the sh-DANCR+miR-656 inhibitor group were obviously increased, and the apoptosis rate and miR-656 expression were obviously reduced (P < 0.05), while the expression of DANCR was not obvious (P>0.05). Compared with the sh-DANCR+pcDNA 3.1 group, the proliferation rate, invasion, migration number, BMPR1A mRNA, BMPR1A, PD-1, and PD-L1 expression of U87 cells in the sh-DANCR+pcDNA 3.1 BMPR1A group obviously increased, and the apoptosis rate obviously decreased (P < 0.05), while here was no statistically obvious difference in miR-656 expression and DANCR expression (P>0.05). DANCR and miR-656 had a targeted negative regulatory relationship. Conclusion: LncRNA DANCR improves the immune microenvironment of glioma cells and inhibits the malignant behavior development of cancer cells by regulating the miR-656/BMPR1A axis.

Key words: LncRNA DANCR, MiR-656/BMPR1A axis, Glioma cells, Immune microenvironment, Malignant behavior development

CLC Number: 

  • R739.41

Table 1

Sequence of qRT-PCR primers"

Primer name Orientation Sequence(5′ to 3′)
DANCR Forward GCGCCACTATGTAGCGGGTT
Reverse TCAATGGCTTGTGCCTGTAGTT
miR-656 Forward GTCAGAAAATGGAGTAACCTTA
Reverse GTCAGAAAATGGAGTAACCTTA
BMPR1A Forward TAGTTCGCTGAACCAATAAAGG
Reverse GTCAGAAAATGGAGTAACCTTA
β-actin Forward GCTAATATCTATAATC
Reverse GAGGCTATCTTCATAGAT
U6 Forward CTCGCTTCGGCAGCACA
Reverse AACGCTTCACGAATTTGCGT

Table 2

Comparison of mRNA expression of DANCR, miR-656 and BMPR1A in cells"

Group DANCR miR-656 BMPR1A mRNA
NHA 0.94±0.10 0.92±0.10 1.02±0.11
LN229 1.51±0.16* 0.66±0.07* 1.41±0.15*
U251 1.55±0.16* 0.62±0.07* 1.47±0.15*
A172 1.62±0.17* 0.58±0.06* 1.57±0.16*
U87 2.03±0.21* 0.42±0.05* 2.03±0.21*

Table 3

Changes in proliferation rate of U87 cells in each group"

Group Proliferation rate/%
Blank 94.22±4.51
NC sh 94.11±4.49
sh-DANCR 47.52±4.82a，b
pcDNA 3.1 94.24±4.49
pcDNA 3.1 DANCR 125.34±6.85c
sh-DANCR+NC inhibitor 47.67±4.79
sh-DANCR+miR-656 inhibitor 72.14±7.31d
sh-DANCR+pcDNA 3.1 47.72±4.81
sh-DANCR+pcDNA 3.1 BMPR1A 72.54±7.38e

Figure 1

Observation of invasion changes of U87 cells NC, negative control; sh, short hairpin; DANCR, differentiation antagonizing non-protein coding RNA; BMPR1A, bone morphogenetic protein receptor type 1A."

Figure 2

Observation of migration changes of U87 cells NC, negative control; sh, short hairpin; DANCR, differentiation antagonizing non-protein coding RNA; BMPR1A, bone morphogenetic protein receptor type 1A."

Table 4

Changes in invasion and migration numbers of U87 cells"

Groups Invasion count Migration count
Blank 112.46±11.34 102.61±10.47
NC sh 108.94±11.27 105.81±10.62
sh-DANCR 70.88±7.18a, b 51.46±5.24a, b
pcDNA 3.1 111.74±11.20 104.55±10.53
pcDNA 3.1 DANCR 150.54±15.21c 145.84±14.75c
sh-DANCR+NC inhibitor 71.44±7.21 52.37±5.31
sh-DANCR+miR-656 inhibitor 108.72±11.04d 91.48±9.25d
sh-DANCR+pcDNA 3.1 71.67±7.20 52.53±5.29
sh-DANCR+pcDNA 3.1 BMPR1A 109.34±11.07e 91.66±9.28e

Figure 3

Observation of apoptosis changes of U87 cells NC, negative control; sh, short hairpin; DANCR, differentiation antagonizing non-protein coding RNA; BMPR1A, bone morphogenetic protein receptor type 1A."

Table 5

The apoptosis rates of U87 cells in each group"

Group Apoptosis rate/%
Blank 12.51±1.28
NC sh 12.63±1.29
sh-DANCR 37.82±3.86a, b
pcDNA 3.1 12.58±1.28
pcDNA 3.1 DANCR 7.67±0.79c
sh-DANCR+NC inhibitor 37.64±3.79
sh-DANCR+miR-656 inhibitor 21.04±2.18d
sh-DANCR+pcDNA 3.1 37.74±3.82
sh-DANCR+pcDNA 3.1 BMPR1A 21.17±2.24e

Table 6

Changes in mRNA expression of DANCR, miR-656, and BMPR1A in U87 cells"

Group DANCR miR-656 BMPR1A mRNA
Blank 1.05±0.11 0.98±0.10 0.94±0.10
NC sh 1.06±0.11 1.02±0.11 0.98±0.10
sh-DANCR 0.45±0.05a, b 1.67±0.18a, b 0.55±0.06a, b
pcDNA 3.1 0.97±0.10 0.92±0.10 1.05±0.11
pcDNA 3.1 DANCR 1.55±0.16c 0.57±0.06c 1.72±0.18c
sh-DANCR+NC inhibitor 0.48±0.05 1.64±0.18 0.58±0.06
sh-DANCR+miR-656 inhibitor 0.46±0.05 1.08±0.11d 0.88±0.09d
sh-DANCR+pcDNA 3.1 0.47±0.05 1.62±0.18 0.56±0.06
sh-DANCR+pcDNA 3.1 BMPR1A 0.42±0.05 1.59±0.11 0.83±0.09e

Figure 4

Binding sites of DANCR and miR-656 DANCR, differentiation antagonizing non-protein coding RNA; WT, wild-type; MUT, mutant."

Table 7

Verification of targeting relationship between DANCR and miR-656"

Group relative luciferase activity
NC mimics+DANCR-WT 1.07±0.11
miR-656 mimics+DANCR-WT 0.62±0.07a
NC mimics+DANCR-MUT 1.03±0.11
miR-656 mimics+DANCR-MUT 1.06±0.11

Figure 5

Expression of BMPR1A, PD-1, and PD-L1 proteins in cells A, blank group; B, NC sh group; C, sh-DANCR group; D, pcDNA 3.1 group; E, pcDNA 3.1 DANCR group; F, sh-DANCR + NC inhibitor group; G, sh-DANCR + miR-656 inhibitor group; H, sh-DANCR + pcDNA 3.1 group; I, sh-DANCR + pcDNA 3.1 BMPR1A group. NC, negative control; sh, short hairpin; DANCR, differentiation antagonizing non-protein coding RNA; BMPR1A, bone morphogenetic protein receptor type 1A."

Table 8

Changes in the expression of BMPR1A, PD-1, and PD-L1 in U87 cells"

Groups BMPR1A/β-actin PD-1/β-actin PD-L1/β-actin
Blank 1.24±0.13 0.83±0.09 0.77±0.08
NC sh 1.27±0.13 0.87±0.09 0.71±0.08
sh-DANCR 0.65±0.07a，b 0.41±0.05a，b 0.34±0.04a，b
pcDNA 3.1 1.25±0.13 0.85±0.09 0.75±0.08
pcDNA 3.1 DANCR 1.68±0.17c 1.37±0.14c 1.14±0.12c
sh-DANCR+NC inhibitor 0.68±0.07 0.48±0.05 0.36±0.04
sh-DANCR+miR-656 inhibitor 0.92±0.10d 0.78±0.08d 0.64±0.07d
sh-DANCR+pcDNA 3.1 0.65±0.07 0.46±0.05 0.37±0.04
sh-DANCR+pcDNA 3.1 BMPR1A 0.97±0.10e 0.72±0.08e 0.66±0.07e
1
Chen Q , Wang W , Wu Z , et al. Over-expression of lncRNA TMEM161B-AS1 promotes the malignant biological behavior of glioma cells and the resistance to temozolomide via up-regulating the expression of multiple ferroptosis-related genes by sponging hsa-miR-27a-3p[J]. Cell Death Discov, 2021, 7, 311.

doi: 10.1038/s41420-021-00709-4
2
Qi ZY , Wang LL , Qu XL . lncRNA LINC00355 acts as a novel biomarker and promotes glioma biological activities via the regulation of miR-1225/FNDC3B[J]. Dis Markers, 2021, 2021, 1683129.
3
Liu R , Wu M , Xu G , et al. Ropivacaine inhibits proliferation, migration, and invasion while inducing apoptosis of glioma cells by regulating the SNHG16/miR-424-5p axis[J]. Open Life Sci, 2020, 15 (1): 988- 999.

doi: 10.1515/biol-2020-0108
4
Cai Y , Wang M , Cui Y , et al. Differential expression profile of lncRNA in glioma cells and the effect of lncRNA NKX3-1 on glioma cells through Fem1b/SPDEF pathway[J]. Front Oncol, 2021, 11, 706863.

doi: 10.3389/fonc.2021.706863
5
Wang YY , Chen C . lncRNA-DANCR promotes taxol resistance of prostate cancer cells through modulating the miR-33b-5p-LDHA axis[J]. Dis Markers, 2022, 2022, 9516774.
6
Yu W , Ma L , Li X . DANCR promotes glioma cell autophagy and proliferation via the miR-33b/DLX6/ATG7 axis[J]. Oncol Rep, 2023, 49 (2): 39- 51.

doi: 10.3892/or.2023.8476
7
Jin Z , Li H , Long Y , et al. microRNA-1269 is downregulated in glioblastoma and its maturation is regulated by long non-coding RNA SLC16A1 antisense RNA 1[J]. Bioengineered, 2022, 13 (5): 12749- 12759.

doi: 10.1080/21655979.2022.2070581
8
Guo M , Jiang Z , Zhang X , et al. miR-656 inhibits glioma tumorigenesis through repression of BMPR1A[J]. Carcinogenesis, 2014, 35 (8): 1698- 1706.

doi: 10.1093/carcin/bgu030
9
Shree B , Tripathi S , Sharma V . Transforming growth factor-beta-regulated LncRNA-MUF promotes invasion by modulating the miR-34a Snail1 axis in glioblastoma multiforme[J]. Front Oncol, 2022, 11, 788755.

doi: 10.3389/fonc.2021.788755
10
Li Z , Li M , Xia P , et al. Targeting long non-coding RNA PVT1/TGF-β/Smad by p53 prevents glioma progression[J]. Cancer Biol Ther, 2022, 23 (1): 225- 233.

doi: 10.1080/15384047.2022.2042160
11
Zhong X , Cai Y . Long non-coding RNA (lncRNA) HOXD-AS2 promotes glioblastoma cell proliferation, migration and invasion by regulating the miR-3681-5p/MALT1 signaling pathway[J]. Bioengineered, 2021, 12 (2): 9113- 9127.

doi: 10.1080/21655979.2021.1977104
12
Jia H , Yan X . lncRNA MEG3 inhibits the proliferation and growth of glioma cells by downregulating bcl-xL in the PI3K/Akt/NF-κB signal pathway[J]. BioMed Res Int, 2022, 2022, 3729069.

doi: 10.1155/2022/3729069
13
Ping Q , Shi Y , Yang M , et al. LncRNA DANCR regulates lymphatic metastasis of bladder cancer via the miR-335/VEGF-C axis[J]. Transl Androl Urol, 2021, 10 (4): 1743- 1753.

doi: 10.21037/tau-21-226
14
Sun W , Zu S , Shao G , et al. Long non-coding DANCR targets miR-185-5p to upregulate LIM and SH3 protein 1 promoting prostate cancer via the FAK/PI3K/AKT/GSK3β/snail pathway[J]. J Gene Med, 2021, 23 (7): e3344.

doi: 10.1002/jgm.3344
15
陈兰玉, 胡凯文. 基于PD-1/PD-L1信号通路中医药改善肿瘤免疫抑制微环境研究进展[J]. 中国中医药信息杂志, 2020, 27 (2): 135- 137.
16
Feng L , Lin T , Che H , et al. Long noncoding RNA DANCR knockdown inhibits proliferation, migration and invasion of glioma by regulating miR-135a-5p/BMI1[J]. Cancer Cell Int, 2020, 20 (1): 53.

doi: 10.1186/s12935-020-1123-4
17
Han J , Yu X , Wang S , et al. IGF2BP2 induces U251 glioblastoma cell chemoresistance by inhibiting FOXO1-mediated PID1 expression through stabilizing lncRNA DANCR[J]. Front Cell Dev Biol, 2022, 9, 659228.

doi: 10.3389/fcell.2021.659228
18
Zhao H , Li J , Yan X , et al. LncRNA MAFG-AS1 suppresses the maturation of miR-34a to promote glioblastoma cell proliferation[J]. Cancer Manag Res, 2021, 13, 3493- 3501.

doi: 10.2147/CMAR.S274615
19
Zheng D , Chen D , Lin F , et al. LncRNA NNT-AS1 promote glioma cell proliferation and metastases through miR-494-3p/PRMT1 axis[J]. Cell Cycle, 2020, 19 (13): 1621- 1631.

doi: 10.1080/15384101.2020.1762037
20
Jia J , Zhu X , Xue K , et al. LncRNA DANCR enhances angiogenesis to promote melanoma progression via sponging miR-5194[J]. J Cancer, 2023, 14 (7): 1161- 1173.

doi: 10.7150/jca.81723
[1] Xiaodong CHAI,Ziwen SUN,Haishuang LI,Liangyi ZHU,Xiaodan LIU,Yantao LIU,Fei PEI,Qing CHANG. Clinicopathological characteristics of the CD8+ T lymphocytes infiltration and its mechanism in distinct molecular subtype of medulloblastoma [J]. Journal of Peking University (Health Sciences), 2024, 56(3): 512-518.
[2] Xiang CAI,Rendong WANG,Shijia WANG,Ziqi REN,Qiuhong YU,Dongguo LI. Dynamic trajectory and cell communication of different cell clusters in malignant progression of glioblastoma [J]. Journal of Peking University (Health Sciences), 2024, 56(2): 199-206.
[3] GAO Yang-xu, ZHANG Hong-wu, SHEN Li-xue, LIU Bao-fu, YAO Hong-xin. Peri-operation treatment for patients with hemophilia A in children with intracranial malignant tumor: a report of 2 cases [J]. Journal of Peking University(Health Sciences), 2015, 47(6): 1037-1038.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Copyright © Journal of Peking University (Health Sciences), All Rights Reserved.
Powered by Beijing Magtech Co. Ltd