Journal of Peking University (Health Sciences) ›› 2025, Vol. 57 ›› Issue (2): 245-252. doi: 10.19723/j.issn.1671-167X.2025.02.004

Previous Articles     Next Articles

Effect of CMTM6 on PD-L1 in Helicobacter pylori infected gastric epithelial cells

Wei FU, Jing NING, Weiwei FU, Jing ZHANG*(), Shigang DING*()   

  1. Department of Gastroenterology, Peking University Third Hospital; Beijing Key Laboratory for Helicobacter Pylori Infection and Upper Gastrointestinal Diseases, Beijing 100191, China
  • Received:2021-11-16 Online:2025-04-18 Published:2025-04-12
  • Contact: Jing ZHANG, Shigang DING E-mail:sihuizhang@sina.com;dingshigang222@163.com
  • Supported by:
    the National Natural Science Foundation of China(81870386)

RICH HTML

  

Abstract:

Objective: To explore the changes of CKLF-like MARVEL transmembrane domain-containing 6 (CMTM6) and programmed death-ligand 1 (PD-L1) expression in gastric mucosal epithelial cells after Helicobacter pylori infection and the regulation of CMTM6 on PD-L1, and to analyze the mRNA expression differences before and after CMTM6 gene knock-out in helicobacter pylori infected gastric epithelial cells by microarray analysis. Methods: The standard Helicobacter pylori strain ATCC 26695 was co-cultured with human gastric epithelial cell GES-1 for 6, 24 and 48 hours, and the mRNA and protein levels of CMTM6 and PD-L1 were detected by real-time quantitative PCR and Western blot. Using CRISPR/Cas9 to construct CMTM6 gene knockout plasmid and knockout CMTM6 gene of GES-1 cells. Helicobacter pylori was co-cultured with CMTM6 gene knockout and wild type GES-1 cells for 48 hours to detect PD-L1 transcription and protein level changes, and CMTM6 gene knockout GES-1 cells were treated with the proteasome inhibitor MG-132 to detect the changes in PD-L1 protein levels. Agilent Human ceRNA Microarray 2019 was used to detect the differentially expressed genes in CMTM6 gene knockout and wild-type GES-1 cells co-cultured with Hp for 48 hours, and the signal pathway of differentially expressed genes enrichment was analyzed by Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Results: The mRNA and protein levels of CMTM6 and PD-L1 in GES-1 cells were significantly up-regulated after Helicobacter pylori infection, and CMTM6 mRNA was most significantly up-regulated 48 hours after infection. After CMTM6 gene knockout, the CD274 gene transcription level of Helicobacter pylori infected GES-1 cells did not change significantly, but PD-L1 protein level was significantly down-regulated, and the PD-L1 level increased after the application of proteasome inhibitor MG-132. After CMTM6 gene knockout, 67 genes had more than two times of differential expression. The transcription levels of TMEM68, FERMT3, GPR142, ATP6V1FNB, NOV, UBE2S and other genes were significantly down-regulated. The transcription levels of PCDHGA6, CAMKMT, PDIA2, NTRK3, SPOCK1 and other genes were significantly up-regulated. After CMTM6 gene knockout, ubiquitin-conjugating enzyme E2S (UBE2S) gene expression was significantly down-regulated, which might affect protein ubiquitination degradation. After CMTM6 gene knockout, adrenoceptor alpha 1B (ADRA1B), cholinergic receptor muscarinic 1 (M1), CHRM1, platelet activating factor receptor (PTAFR) gene expression was significantly up-regulated. Conclusion: Helicobacter pylori infection up-regulates the expression level of CMTM6 in gastric mucosa cells, and CMTM6 can stabilize PD-L1 and maintain the protein level of PD-L1. CMTM6 gene knockout may affect biological behaviors such as protein ubiquitination and cell surface receptor expression.

Key words: Gastric mucosa, Epithelial cells, Helicobacter pylori, MARVEL domain-containing proteins (CMTM6), B7-H1 antigen (PD-L1)

CLC Number: 

  • 735.2

Figure 1

The mRNA and protein expressions of CMTM6 and PD-L1 in GES-1 cells infected with Hp 26695 detected by RT-qPCR and Western blot * *P < 0.01, vs. 0 h. Hp, Helicobacter pylori; PD-L1, programmed death-ligand 1; CMTM6, CKLF-like MARVEL transmembrane domain-containing 6."

Table 1

sgRNA sequence targeting CMTM6 gene"

sgRNA Sequence (5′→ 3′)
sgRNA-F CACCGCGGCCCGAGGCGATGGAGAA
sgRNA-R AAACTTCTCCATCGCCTCGGGCCGC

Figure 2

Verification of CMTM6 gene knockout in GES-1 cells A, sgRNA-F fragment in CMTM6 gene knockout plasmid detected by Sanger sequencing; B, CMTM6 mRNA and CMTM6 protein expressions in CMTM6 gene wild-type/knockout GES-1 cells detected by RT-qPCR and Western blot. * *P < 0.01. CMTM6, CKLF-like MARVEL transmembrane domain-containing 6; WT, wild-type; KO, knockout."

Figure 3

mRNA and protein expressions of CMTM6, PD-L1 in CMTM6 gene wild-type/knockout GES-1 cells before and after Hp 26695 infection detected by RT-qPCR and Western blot * *P < 0.01. CMTM6, CKLF-like MARVEL transmembrane domain-containing 6; Hp, Helicobacter pylori; WT, wild-type; KO, knockout; PD-L1, programmed death-ligand 1."

Figure 4

The level of PD-L1 protein in GES-1 cells after CMTM6 gene knockout and protease inhibitor MG-132 treatment were detected by Western blot CMTM6, CKLF-like MARVEL transmembrane domain-containing 6; KO, knockout; PD-L1, programmed death-ligand 1."

Figure 5

Cluster analysis and volcanic map of CMTM6 gene knockout/wild-type GES-1 differentially expressed genes Each point in the graph represents a differentially expressed gene, with the horizontal axis representing the logarithmic value (log2 FC) of the fold diffe-rence in gene expression between two sets of samples, and the vertical axis representing the statistically significant negative logarithmic value [-lg (P value)] of gene expression changes. The larger the absolute value of the horizontal axis, the greater the difference in expression levels between the two groups; The larger the absolute value of the vertical axis, the more significant the differential expression."

Table 2

Up-regulated genes after CMTM6 gene knockout"

Rank Gene symbol Fold change P
1 PCDHGA6 3.962 0.009
2 CAMKMT 3.478 0.007
3 PDIA2 3.430 0.001
4 NTRK3 3.371 0.001
5 SPOCK1 3.085 0.001

Table 3

Down-regulated genes after CMTM6 gene knockout"

Rank Gene symbol Fold change P
1 TMEM68 -3.782 0.005
2 FERMT3 -3.269 0.012
3 GPR142 -3.059 0.003
4 ATP6V1FNB -2.938 0.002
5 NOV -2.809 0.003

Figure 6

KEGG enrichment analysis of differentially expressed genes PPAR, peroxisome proliferator-activated receptor; KEGG, Kyoto Encyclopedia of Genes and Genomes."

Table 4

KEGG enrichment analysis gene list"

Rank Term description Gene symbols P
1 Neuroactive ligand-receptor interaction ADRA1B, CHRM1, PTAFR, CGA 0.019 3
2 Calcium signaling pathway ADRA1B, CHRM1, PTAFR 0.023 9
3 Melanogenesis GNAO1, WNT10A 0.046 9
4 Cholinergic synapse GNAO1, CHRM1 0.056 4
5 Serotonergic synapse SLC6A4, GNAO1 0.057 3
6 Other types of O-glycan biosynthesis B3GLCT 0.073 3
7 Protein export IMMP2L 0.076 5
8 Retrograde endocannabinoid signaling NDUFB1, GNAO1 0.084 3
9 Adrenergic signaling in cardiomyocytes ADRA1B, CACNG8 0.087 4
10 Phototransduction SAG 0.092 4
1 Oster P , Vaillant L , Riva E , et al. Helicobacter pylori infection has a detrimental impact on the efficacy of cancer immunotherapies[J]. Gut, 2022, 71 (3): 457- 466.
doi: 10.1136/gutjnl-2020-323392
2 Correa P . Human gastric carcinogenesis: A multistep and multifactorial process. First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention[J]. Cancer Res, 1992, 52 (24): 6735- 6740.
3 Asaka M , Sugiyama T , Nobuta A , et al. Atrophic gastritis and intestinal metaplasia in Japan: Results of a large multicenter study[J]. Helicobacter, 2001, 6 (4): 294- 299.
doi: 10.1046/j.1523-5378.2001.00042.x
4 Zhao M , Liu Q , Liu W , et al. MicroRNA140 suppresses Helicobacter pyloripositive gastric cancer growth by enhancing the antitumor immune response[J]. Mol Med Rep, 2019, 20 (3): 2484- 2492.
5 Xie G , Li W , Li R , et al. Helicobacter pylori promote B7-H1 expression by suppressing miR-152 and miR-200b in gastric cancer cells[J]. PLoS One, 2017, 12 (1): e0168822.
doi: 10.1371/journal.pone.0168822
6 Holokai L , Chakrabarti J , Broda T , et al. Increased programmed death-ligand 1 is an early epithelial cell response to Helicobacter pylori infection[J]. PLoS Pathog, 2019, 15 (1): e1007468.
doi: 10.1371/journal.ppat.1007468
7 Beswick EJ , Pinchuk IV , Das S , et al. Expression of the programmed death ligand 1, B7-H1, on gastric epithelial cells after Helicobacter pylori exposure promotes development of CD4+ CD25+ FoxP3+ regulatory T cells[J]. Infect Immun, 2007, 75 (9): 4334- 4341.
doi: 10.1128/IAI.00553-07
8 Wu YY , Lin CW , Cheng KS , et al. Increased programmed death-ligand-1 expression in human gastric epithelial cells in Helicobacter pylori infection[J]. Clin Exp Immunol, 2010, 161 (3): 551- 559.
doi: 10.1111/j.1365-2249.2010.04217.x
9 Burr ML , Sparbier CE , Chan YC , et al. CMTM6 maintains the expression of PD-L1 and regulates anti-tumour immunity[J]. Nature, 2017, 549 (7670): 101- 105.
doi: 10.1038/nature23643
10 Mezzadra R , Sun C , Jae LT , et al. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators[J]. Nature, 2017, 549 (7670): 106- 110.
doi: 10.1038/nature23669
11 Guan X , Zhang C , Zhao J , et al. CMTM6 overexpression is associated with molecular and clinical characteristics of malignancy and predicts poor prognosis in gliomas[J]. EBioMedicine, 2018, 35, 233- 243.
doi: 10.1016/j.ebiom.2018.08.012
12 Tian Y , Sun X , Cheng G , et al. The association of CMTM6 expression with prognosis and PD-L1 expression in triple-negative breast cancer[J]. Ann Transl Med, 2021, 9 (2): 131.
doi: 10.21037/atm-20-7616
13 Ishihara S , Iwasaki T , Kohashi K , et al. The association between the expression of PD-L1 and CMTM6 in undifferentiated pleomorphic sarcoma[J]. J Cancer Res Clin Oncol, 2021, 147 (7): 2003- 2011.
doi: 10.1007/s00432-021-03616-4
14 Li X , Chen L , Gu C , et al. CMTM6 significantly relates to PD-L1 and predicts the prognosis of gastric cancer patients[J]. PeerJ, 2020 (8): e9536.
15 Wang Z , Peng Z , Liu Q , et al. Co-expression with membrane CMTM6/4 on tumor epithelium enhances the prediction value of PD-L1 on anti-PD-1/L1 therapeutic efficacy in gastric adenocarcinoma[J]. Cancers (Basel), 2021, 13 (20): 5175.
doi: 10.3390/cancers13205175
16 Chen L , Yang QC , Li YC , et al. Targeting CMTM6 suppresses stem cell-like properties and enhances antitumor immunity in head and neck squamous cell carcinoma[J]. Cancer Immunol Res, 2020, 8 (2): 179- 191.
doi: 10.1158/2326-6066.CIR-19-0394
17 Huang X , Xiang L , Wang B , et al. CMTM6 promotes migration, invasion, and EMT by interacting with and stabilizing vimentin in hepatocellular carcinoma cells[J]. J Transl Med, 2021, 19 (1): 120.
doi: 10.1186/s12967-021-02787-5
18 Jin MH , Nam AR , Park JE , et al. Therapeutic co-targeting of WEE1 and ATM downregulates PD-L1 expression in pancreatic cancer[J]. Cancer Res Treat, 2020, 52 (1): 149- 166.
doi: 10.4143/crt.2019.183
19 Tanaka E , Miyakawa Y , Kishikawa T , et al. Expression of circular RNA CDR1AS in colon cancer cells increases cell surface PDL1 protein levels[J]. Oncol Rep, 2019, 42 (4): 1459- 1466.
20 Yamamoto Y , Kakizaki M , Shimizu T , et al. PD-L1 is induced on the hepatocyte surface via CKLF-like MARVEL transmembrane domain-containing protein 6 up-regulation by the anti-HBV drug entecavir[J]. Int Immunol, 2020, 32 (8): 519- 531.
doi: 10.1093/intimm/dxaa018
21 Ho JY , Lu HY , Cheng HH , et al. UBE2S activates NF-κB signaling by binding with IκBα and promotes metastasis of lung adenocarcinoma cells[J]. Cell Oncol (Dordr), 2021, 44 (6): 1325- 1338.
[1] Jingyao WEI, Juxiang YE, Meiling ZHOU, Weiwei FU, Xin LIU, Kangle ZHAI, Yanyan SHI, Shigang DING, Jing ZHANG. Endoscopic characteristics of primary gastric lymphoma and prediction of treatment response [J]. Journal of Peking University (Health Sciences), 2026, 58(2): 342-350.
[2] Xue-li TIAN,Zhi-qiang SONG,Bao-jun SUO,Li-ya ZHOU,Cai-ling LI,Yu-xin ZHANG. Comparison of Epsilometer test and agar dilution method in detecting the sensitivity of Helicobacter pylori to metronidazole [J]. Journal of Peking University (Health Sciences), 2023, 55(5): 934-938.
[3] Wei-hua HOU,Shu-jie SONG,Zhong-yue SHI,Mu-lan JIN. Clinicopathological features of Helicobacter pylori-negative early gastric cancer [J]. Journal of Peking University (Health Sciences), 2023, 55(2): 292-298.
[4] WANG Zi-jing,LI Zai-ling. Characteristics of gastric microbiota in children with Helicobacter pylori infection family history [J]. Journal of Peking University (Health Sciences), 2021, 53(6): 1115-1121.
[5] YANG Guang, CHENG Qing-li, LI Chun-lin, JIA Ya-li, YUE Wen, PEI Xue-tao, LIU Yang, ZHAO Jia-hui, DU Jing, AO Qiang-guo. High glucose reduced the repair function of kidney stem cells conditional medium to  the hypoxia-injured renal tubular epithelium cells [J]. Journal of Peking University(Health Sciences), 2017, 49(1): 125-130.
[6] YU Jing-ting,MENG Huan-xin, LIU Kai-ning. An modified culture method of primary human gingival epithelial cells [J]. Journal of Peking University(Health Sciences), 2016, 48(4): 733-737.
[7] REN Yu-Lan, ZHAN Yuan, LU Lu, LI Sheng-Lin, FU Xin, YU Guang-Yan, CAO Tong, LIU He. Expression characteristics of epithelial markers in human embryonic stem cells differentiating into keratinocytes [J]. Journal of Peking University(Health Sciences), 2015, 47(2): 305-311.
[8] ZHONG Jin-Sheng, MEI Fang, ZHANG Hong-Quan. Comparison of biological characteristics of human gingival junctional epithelial cells and oral epithelial cells [J]. Journal of Peking University(Health Sciences), 2015, 47(1): 32-36.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!