Journal of Peking University(Health Sciences) ›› 2019, Vol. 51 ›› Issue (5): 900-906. doi: 10.19723/j.issn.1671-167X.2019.05.018

Previous Articles     Next Articles

Comparative study of differentiation potential of mesenchymal stem cells derived from orofacial system into vascular endothelial cells

Jing XIE1,Yu-ming ZHAO1,Nan-quan RAO1,Xiao-tong WANG2,Teng-jiao-zi FANG1,Xiao-xia LI1,Yue ZHAI1,Jing-zhi LI1,Li-hong GE1,Yuan-yuan WANG1,()   

  1. 1. Department of Pediatric Dentistry, Peking University School and Hospital of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
    2. Department of Oral Emergency, Peking University School and Hospital of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
  • Received:2017-10-10 Online:2019-10-18 Published:2019-10-24
  • Contact: Yuan-yuan WANG E-mail:cwyyd@126.com
  • Supported by:
    Supported by National Natural Science Youth Foundation of China(81500837)

RICH HTML

  

Abstract:

Objective: To compare the proliferation and capacity of differentiation to vascular endothelial cells and angiogenesis induction among stem cells from human exfoliated deciduous teeth (SHED), dental pulp stem cells (DPSC) and human bone marrow mesenchymal stem cells (BMSC) from orofacial bone. Methods: SHED and DPSC were isolated from pulp tissue of the patients. BMSC were isolated from orthognathic or alveolar surgical sites. The surface markers of the cells were detected by flowcytometry. Cell counting kit-8 (CCK-8) assays were conducted to detect the proliferation ability of the cells. The cells were induced into endothelial cells with conditional medium and then the induced cells were cultured in Matrigel medium. The expression of angiogenesis-related genes such as platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31), vascular endothelial growth factor (VEGF), vascular endothelial growth factor receptor 1 (VEGFR1), vascular endothelial growth factor receptor 2 (VEGFR2) and von Willebrand Factor (vWF) were quantified by real-time PCR. The cells were cultured in chick embryo chorioallantoic membrane (CAM) and the vessels were counted after 5 days. Results: The cell surface markers CD73, CD90, CD105 and CD146 of all the stem cells were positive, CD34 and CD45 were negative. The CD146 positive rate of SHED and DPSC was higher than that of BMSC. SHED had a higher proliferation rate than DPSC and BMSC. After angiogenic induction for 14 d, 3 kinds of cells emanated pseudopodia formed grid structure long vasculature in Matrigel media. The total length of tube formation of induced BMSC (7 759.7 μm) and SHED (7 734.3 μm) was higher than DPSC (5 541.0 μm). The meshes number of induced SHED (70.7) was higher than DPSC (60) and BMSC (53.7) in Matrigel medium. The expression of CD31, VEGFR2 and vWF genes of SHED were higher than those of BMSC and DPSC. VEGFR1 gene expression of BMSC was higher than that of the other groups, and SHED was higher than DPSC. The expression of VEGF showed no difference among the cells. No deference was showed between the effect of the stem cells and negative control on new formed vessels in CAM. The total length of vessels of SHED (30.4 mm) was higher than that of the negative control (20.9 mm) and BMSC (28.0 mm). Conclusion: SHED, DPSC and BMSC can differentiate into vascular endothelial cells. SHED showed a stronger angiogenesis differentiation and proliferation potential compared with DPSC and BMSC.

Key words: Stem cells from human exfoliated deciduous teeth, Dental pulp stem cells, Bone marrow mesenchymal stem cells, Differentiation into vascular endothelial cells, Cell proliferation

CLC Number: 

  • R78

Table 1

Specific primer for real-time PCR"

Gene Primer(5' to 3') Size/bp
CD31 F: TGTCAAGTAAGGTGGTGGAGTCT
R: AGGCGTGGTTGGCTCTGTT
222
VEGF F: CCCACTGAGGAGTCCAACAT
R: AAATGCTTTCTCCGCTCTGA
296
VEGFR1 F: ACCTCACTGCCACTCTAATTGTCA
R: AAGTCACACCTTGCTTCGGAATG
196
VEGFR2 F: ACGGACAGTGGTATGGTTCTTGCC
R: GGTAGCCGCTTGTCTGGTTTGAG
145
vWF F: GGGGTCATCTCTGGATTCAAG
R: TCTGTCCTCCTCTTAGCTGAA
145
GAPDH F: CTGGGCTACACTGAGCACC
R: AAGTGGTCGTTGAGGGCAATG
101

Figure 1

Surface marker of BMSC, DPSC and SHED observed by flow cytometry The cell surface markers CD73, CD90, CD105 and CD146 of all stem cells were positive, CD34 and CD45 were negative. SHED, stem cells from human exfoliated deciduous teeth; DPSC, dental pulp stem cell; BMSC, bone marrow mesenchymal stem cell."

Figure 2

The growth curve of BMSC, DPSC and SHED during a 9-day period CCK-8 assay, SHED had a higher proliferation rate than DPSC and BMSC. * P<0.05. Abbreviations as in Figure 1."

Figure 3

Induced stem cells in Matrigel medium showing vasculature formation A, BMSC; B, DPSC; C, SHED. D, cells without induction showed no formation of vessels; E, CD31; F, vWF; G, the total length of tube formation of induced BMSC and SHED is higher than DPSC in Matrigel medium; H, the meshes number of induced SHED is higher than DPSC and BMSC in Matrigel medium. A to C, induced stem cells in Matrigel medium under phase contrast microscope, showing vasculature formation(×100); E and F, Immunocytochemical results of induced cells, showing positive CD31 and vWF expression. * P<0.05."

Figure 4

The expression of angiogenesis-related genes after induction A, SHED; B, DPSC; C, BMSC; D, negative control; RQ, relative quantification. CD31, platelet endothelial cell adhesion molecule-1; VEGF, vascular endothelial growth factor; VEGFR1, vascular endothelial growth factor receptor 1; VEGFR2, vascular endothelial growth factor receptor 2; vWF, von Willebrand factor. * P<0.05."

Figure 5

Effect of BMSC, DPSC and SHED on new formed vessels in CAM under phase contrast microscope A, SHED; B, DPSC; C, BMSC; D, negative control; E, statistically analysis showed no significantly difference among groups; F, statistically analysis showed the length of vessels of SHED was higher than negative control and BMSC (P<0.05). A to D, Effect of SHED, BMSC and DPSC on new formed vessels in CAM under phase contrast microscope (×40)."

[1] Sakaguchi Y, Sekiya I, Yagishita K , et al. Comparison of human stem cells derived from various mesenchymal tissues: superiority of synovium as a cell source[J]. Arthritis Rheumatol, 2005,52(8):2521.
[2] Folkman J . Angiogenesis in cancer, vascular, rheumatoid and other disease[J]. Nat Med, 1995,1(1):27.
[3] Carmeliet P . Angiogenesis in life, disease and medicine[J]. Nature, 2005,438(7070):932.
[4] Canan A, Huseyin A, Riza KA , et al. Angiogenesis in inflammatory bowel disease[J]. In J Inflammation, 2015,2015(3):970890.
[5] Tateishi-Yuyama E, Matsubara H, Murohara T . Therapeutic angiogenesis for patients with limb ischemia by autologous transplantation of bone-marrow cells: a pilot study and a randomized controlled trial[J]. Acc Current J Rev, 2002,360(9331):427.
[6] Hou L, Kim JJ, Woo YJ , et al. Stem cell-based therapies to promote angiogenesis in ischemic cardiovascular disease[J]. Am J Physiol, 2016,310(4):H455.
[7] Shi S, Gronthos S . Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp[J]. J Bone Miner Res, 2003,18(4):696-704.
[8] Belotti A, Elli E, Speranza T , et al. Circulating endothelial cells and endothelial activation in essential thrombocythemia: results from CD146 + immunomagnetic enrichment: flow cytometry and soluble E-selectin detection [J]. Am J Hematol, 2012,87(3):319.
[9] Jouve N, Despoix N, Espeli M , et al. The involvement of CD146 and its novel ligand galectin-1 in apoptotic regulation of endothelial cells[J]. J Biol Chem, 2013,288(4):2571-2579.
[10] Nakamura S, Yamada Y, Katagiri W , et al. Stem cell proliferation pathways comparison between human exfoliated deciduous teeth and dental pulp stem cells by gene expression profile from promising dental pulp[J]. J Endodont, 2009,35(11):1536-1542.
[11] Duttenhoefer F, Lara d FR, Meury T, et al. 3D scaffolds co-seeded with human endothelial progenitor and mesenchymal stem cells: evidence of prevascularisation within 7 days[J]. Eur Cells Mater, 2013,26(4):49.
[12] Moore MC, Pandolfi V, Mcfetridge PS . Novel human-derived extracellular matrix induces in vitro, and in vivo, vascularization and inhibits fibrosis[J]. Biomaterials, 2015,49:37.
[13] Nourse MB, Halpin DE, Scatena M , et al. VEGF induces differentiation of functional endothelium from human embryonic stem cells: implications for tissue engineering[J]. Arterioscler Thromb Vas Biol, 2010,30(1):80-89.
[14] Oswald J, Boxberger S, Jørgensen B , et al. Mesenchymal stem cells can be differentiated into endothelial cells in vitro[J]. Stem Cells, 2004,22(3):377.
[15] Sugiyama M, Iohara K, Wakita H , et al. Dental pulp-derived CD31 -/CD146 - side population stem/progenitor cells enhance recovery of focal cerebral ischemia in rats [J]. Tissue Eng Part A, 2011,17(9/10):1303-1311.
[16] Park S, Sorenson CM, Sheibani N . PECAM-1 isoforms, eNOS and endoglin axis in regulation of angiogenesis[J]. Clin Sci, 2015,129(3):217.
[17] Zhang Z, Neiva KG, Lingen MW , et al. VEGF-dependent tumor angiogenesis requires inverse and reciprocal regulation of VEGFR1 and VEGFR2[J]. Cell Death Differ, 2010,17(3):499.
[18] Ruszkowskaciastek B, Sokup A, Socha M W , et al. A preliminary evaluation of VEGF-A, VEGFR1 and VEGFR2 in patients with well-controlled type 2 diabetes mellitus[J]. J Zhejiang Univ Sci B, 2014,15(6):575-581.
[19] Rondaij MG, Bierings R, Kragt A , et al. Dynamics and plasticity of Weibel-Palade bodies in endothelial cells[J]. Arterioscler Thromb Vasc Biol, 2006,26(5):1002.
[20] Kleibeuker EA, Schulkens IA, Castricum KC , et al. Examination of the role of galectins during in vivo angiogenesis using the chick chorioallantoic membrane assay[J]. Methods Mol Biol, 2015,1207:305.
[21] Dehelean CA, Feflea S, Gheorgheosu D , et al. Anti-angiogenic and anti-cancer evaluation of betulin nanoemulsion in chicken chorioallantoic membrane and skin carcinoma in BALB/c mice[J]. J Biomed Nanotechnol, 2013,9(4):577-589.
[1] Liting ZENG, Kaiyuan CHENG, Zhongning LIU, Jian LI, Jingwen YANG, Ting JIANG. miR-488-5p promotes osteogenic and neurogenic differentiation of rat bone marrow mesenchymal stem cells and enhances neuralized bone regeneration [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 10-21.
[2] Ruofan GAO, Tianyu MA, Runkai WANG, Yuchen YIN, Ruidi LI, Dandan WANG, Bin XIA. Anti-inflammatory effects of cell membrane vesicle-mediated delivery of small interfering RNA targeting tumor necrosis factor-α on dental pulp stem cells [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 22-29.
[3] Ting SHUAI, Yanyan GUO, Chunping LIN, Xiaomei HOU, Chanyuan JIN. Knockdown of NPTX1 promotes osteogenic differentiation of human bone marrow mesenchymal stem cells [J]. Journal of Peking University (Health Sciences), 2025, 57(1): 7-12.
[4] Yao ZHANG,Jinxin GUO,Shijia ZHAN,Enyu HONG,Hui YANG,Anna JIA,Yan CHANG,Yongli GUO,Xuan ZHANG. Role and mechanism of cysteine and glycine-rich protein 2 in the malignant progression of neuroblastoma [J]. Journal of Peking University (Health Sciences), 2024, 56(3): 495-504.
[5] Yu-yang YE,Lin YUE,Xiao-ying ZOU,Xiao-yan WANG. Characteristics and microRNA expression profile of exosomes derived from odontogenic dental pulp stem cells [J]. Journal of Peking University (Health Sciences), 2023, 55(4): 689-696.
[6] SHUAI Ting,LIU Juan,GUO Yan-yan,JIN Chan-yuan. Knockdown of long non-coding RNA MIR4697 host gene inhibits adipogenic differentiation in bone marrow mesenchymal stem cells [J]. Journal of Peking University (Health Sciences), 2022, 54(2): 320-326.
[7] Xiao-min GAO,Xiao-ying ZOU,Lin YUE. Mediated pathways of exosomes uptake by stem cells of apical papilla [J]. Journal of Peking University(Health Sciences), 2020, 52(1): 43-50.
[8] Xia LIU,Ying ni LI,Xiao li SUN,Qing lin PENG,Xin LU,Guo chun WANG. Effects of integrin metalloproteinases on osteogenic differentiation [J]. Journal of Peking University(Health Sciences), 2018, 50(6): 962-967.
[9] TANG Xu, ZHAO Wei-hong, SONG Qin-qin, YIN Hua-qi, DU Yi-qing, SHENG Zheng-zuo, WANG Qiang, ZHANG Xiao-wei, LI Qing, LIU Shi-jun, XU Tao. Influence of SOX10 on the proliferation and invasion of prostate cancer cells [J]. Journal of Peking University(Health Sciences), 2018, 50(4): 602-606.
[10] WANG Zi-cheng, CHENG Li, LV Tong-de, SU Li, LIN Jian, ZHOU Li-qun. Inflammatory priming adipose derived stem cells significantly inhibit the proliferation of peripheral blood mononuclear cells [J]. Journal of Peking University(Health Sciences), 2018, 50(4): 590-594.
[11] CHEN Wei, HU Fan-lei, LIU Hong-jiang, XU Li-ling, LI Ying-ni, LI Zhan-guo. Myeloid-derived suppressor cells promoted autologous B cell proliferation in rheumatoid arthritis [J]. Journal of Peking University(Health Sciences), 2017, 49(5): 819-823.
[12] JIA Wei-qian, ZHAO Yu-ming, GE Li-hong. Recombinant human transforming growth factor β1 promotes dental pulp stem cells proliferation and mineralization [J]. Journal of Peking University(Health Sciences), 2017, 49(4): 680-681.
[13] CAI Yi, GUO Hao, LI Han-zhong, WANG Wen-da, ZHANG Yu-shi. MicroRNA differential expression profile in tuberous sclerosis complex cell line TSC2-/- MEFs and normal cell line TSC2+/+ MEFs [J]. Journal of Peking University(Health Sciences), 2017, 49(4): 580-584.
[14] SIMA Zi-han, HONG Ying-ying, LI Tie-jun△. Effects of PTCH1 mutations on the epithelial proliferation derived from keratocystic odontogenic tumour [J]. Journal of Peking University(Health Sciences), 2017, 49(3): 522-526.
[15] GAO Xiang, CHEN Xiang-mei, ZHANG Ting, ZHANG Jing, CHEN Mo, GUO Zheng--yang, SHI Yan-yan, LU Feng-min, DING Shi-gang. Relationship between macrophage capping protein and gastric cancer cell’s proliferation and migration ability [J]. Journal of Peking University(Health Sciences), 2017, 49(3): 489-494.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!