Email Alert | RSS

Journal of Peking University(Health Sciences) ›› 2020, Vol. 52 ›› Issue (1): 1-9. doi: 10.19723/j.issn.1671-167X.2020.01.001

    Next Articles

Tribbles pseudokinase 3 inhibits the adipogenic differentiation of human adipose-derived mesenchymal stem cells

Xiang-song BAI,Long-wei LV(),Yong-sheng ZHOU   

  1. Department of Prosthodontics, Peking University School and Hospital of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
  • Received:2019-12-14 Online:2020-02-18 Published:2020-02-20
  • Contact: Long-wei LV E-mail:zhoucx2008@126.com
  • Supported by:
    Supported by the National Natural Science Foundation of China(31600787);the Young Elite Scientist Sponsorship Program by CAST(2015QNRC001);the Peking University School of Stomatology for Talented Young Investigators(PKUSS20150107)

RICH HTML

   

PDF (PC)

Abstract:

Objective: To identify the role of Tribbles pseudokinase 3 (TRIB3) during the process of adipogenic differentiation of human adipose-derived mesenchymal stem cells (hASCs), and to provide a new target and a novel idea for the application of hASCs in adipose tissue engineering and soft tissue regeneration. Methods: TRIB3-knockdown hASCs (shTRIB3) and TRIB3-overexpression hASCs (TRIB3-over) were established using lentivirus transfection technique. The transfection effect was estimated by the visible presence of green fluorescence as the expression of green fluorescent protein (GFP) in the transfected hASCs. The lentiviral transfection efficiency was examined by quantitative real-time poly-merase chain reaction (qRT-PCR) and Western blot. After adipogenic induction, Oil Red staining and quantification, as well as qRT-PCR about several specific adipogenic markers were used to evaluate the adipogenic differentiation ability of hASCs. Results: In TRIB3-knockdown hASCs, the TRIB3 mRNA expression level decreased by about 84.3% compared with the control group (P<0.01), and the TRIB3 protein level also showed obvious reduction. Oppositely, in TRIB3-overexpression hASCs, the TRIB3 mRNA expression level increased by approximately 160% compared with the control group (P<0.01), and the TRIB3 protein level also showed a significant increase. These results indicated a successful construction of TRIB3-knockdown hASCs and TRIB3-overexpression hASCs. The Oil Red staining results showed that the down-regulation of TRIB3 significantly promoted lipid droplets formation in hASCs, consistent with Oil Red quantification. On the other hand, the up-regulation of TRIB3 suppressed lipid droplets formation in hASCs, consistent with Oil Red quantification. After adipogenic induction, adipogenesis-related genes, including peroxisome proliferator-activated receptor γ (PPARγ), cluster of differentiation 36 (CD36) and CCAAT/enhancer binding protein α (C/EBPα), were increased significantly in TRIB3-knockdown hASCs compared with the control group (P<0.01). Oppositely, PPARγ, CD36 and lipoprotein lipase (LPL) were significantly decreased in TRIB3-overexpression hASCs compared with the control group (P<0.01). Conclusion: TRIB3 inhibited the adipogenic differentiation of hASCs. Knockdown of TRIB3 promoted the ability of adipogenesis of hASCs, while overexpression of TRIB3 inhibited the adipogenic differentiation of hASCs. Considering the important role of PPARγ in the adipogenis process, the molecular mechanism of the regulatory function of TRIB3 may be related with PPARγ signal pathway.

Key words: Human adipose-derived mesenchymal stem cells, Tribbles pseudokinase 3, Adipogenic differentiation

CLC Number: 

  • R329.2

Table 1

Packaging base sequences of lentiviruses"

Table 2

Primer sequences used for quantitative real-time PCR"

Gene Forward primer (5' to 3') Reverse primer (5' to 3')
GAPDH CGGACCAATACGACCAAATCCG AGCCACATCGCTCAGACACC
TRIB3 GGGTCTGTTTTGCATGCGAGC AGCTCGTTTCTGGACGGGAC
PPARγ GAGGAGCCTAAGGTAAGGAG GTCATTTCGTTAAAGGCTGA
C/EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
LPL CGGATTAACATTGGAGAAGCTATCCG AGCTGGTCCACATCTCCAAGTC
CD36 CGATTAACATAAGTAAAGTTGCCATAATCG CGCAGTGACTTTCCCAATAGGAC

Figure 1

Fluorescent photographs of shTRIB3 and sh-NC hASCs (A), and TRIB3 mRNA and protein expression examined by qRT-PCR (B) and Western blot (C) * P<0.01; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TRIB3, tribbles pseudokinase 3."

Figure 2

Oil Red staining (A) and quantification (B) and the qRT-PCR (C) results after adipogenic induction in TRIB3-knockdown hASCs * P<0.01; NC, negative control; TRIB3, tribbles pseudokinase 3; PM, proliferation medium; AM, adipogenic medium; PPARγ,peroxisome proliferator-activated receptor γ; C/EBPα,CCAAT/enhancer binding protein α; CD36,cluster of differentiation 36."

Figure 3

Fluorescent photographs of TRIB3-over and NC-over hASCs (A),and TRIB3 mRNA and protein expression examined by qRT-PCR (B) and Western blot (C) * P<0.01; NC, negative control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TRIB3, tribbles pseudokinase 3."

Figure 4

Oil Red staining (A) and quantification (B) and the qRT-PCR (C) results after adipogenic induction in TRIB3-overexpression hASCs * P<0.01; NC, negative control; TRIB3, tribbles pseudokinase 3; PM, proliferation medium; AM, adipogenic medium; PPARγ,peroxisome proliferator-activated receptor γ; LPL, lipoprotein lipase; CD36,cluster of differentiation 36."

[1] Rubin JP, Marra KG . Adipose stem cell therapy for soft tissue reconstruction[J]. Lancet, 2013,382(9898):1077-1079.
[2] Patrick CJ, Chauvin PB, Hobley J , et al. Preadipocyte seeded PLGA scaffolds for adipose tissue engineering[J]. Tissue Eng, 1999,5(2):139-151.
[3] Paschos NK, Brown WE, Eswaramoorthy R , et al. Advances in tissue engineering through stem cell-based co-culture[J]. J Tissue Eng Regen Med, 2015,9(5):488-503.
[4] Cossu G, Birchall M, Brown T , et al. Lancet Commission: Stem cells and regenerative medicine[J]. Lancet, 2018,391(10123):883-910.
[5] Zuk PA, Zhu M, Mizuno H , et al. Multilineage cells from human adipose tissue: Implications for cell-based therapies[J]. Tissue Eng, 2001,7(2):211-228.
[6] Zuk PA, Zhu M, Ashjian P , et al. Human adipose tissue is a source of multipotent stem cells[J]. Mol Biol Cell, 2002,13(12):4279-4295.
[7] Gentile P, Orlandi A, Scioli MG , et al. Concise review: Adipose-derived stromal vascular fraction cells and platelet-rich plasma: Basic and clinical implications for tissue engineering therapies in regenerative surgery[J]. Stem Cells Transl Med, 2012,1(3):230-236.
[8] Lv LW, Liu YS, Zhang P , et al. Transcriptomics and functional analysis of graphene-guided osteogenic differentiation of mesenchymal stem cells[J]. Chin J Dent Res, 2018,21(2):101-111.
[9] Eyers PA, Keeshan K, Kannan N . Tribbles in the 21st Century: The evolving roles of tribbles pseudokinases in biology and disease[J]. Trends Cell Biol, 2017,27(4):284-298.
[10] Ord T, Ord T . Mammalian pseudokinase TRIB3 in normal physi-ology and disease: Charting the progress in old and new avenues[J]. Curr Protein Pept Sci, 2017,18(8):819-842.
[11] Prudente S, Sesti G, Pandolfi A , et al. The mammalian tribbles homolog TRIB3, glucose homeostasis, and cardiovascular diseases[J]. Endocr Rev, 2012,33(4):526-546.
[12] Liu G, Jin S, Hu Y , et al. Disease status affects the association between rs4813620 and the expression of Alzheimer’s disease susceptibility gene TRIB3[J]. Proc Natl Acad Sci USA, 2018,115(45):E10519-E10520.
[13] Hua F, Li K, Yu JJ , et al. The TRIB3-SQSTM1 interaction mediates metabolic stress-promoted tumorigenesis and progression via suppressing autophagic and proteasomal degradation[J]. Auto-phagy, 2015,11(10):1929-1931.
[14] Mondal D, Mathur A, Chandra PK . Tripping on TRIB3 at the junction of health, metabolic dysfunction and cancer[J]. Biochimie, 2016,124:34-52.
[15] Kusminski CM, Bickel PE, Scherer PE . Targeting adipose tissue in the treatment of obesity-associated diabetes[J]. Nat Rev Drug Discov, 2016,15(9):639-660.
[16] Picon-Ruiz M, Morata-Tarifa C, Valle-Goffin JJ , et al. Obesity and adverse breast cancer risk and outcome: Mechanistic insights and strategies for intervention[J]. CA Cancer J Clin, 2017,67(5):378-397.
[17] Bezy O, Vernochet C, Gesta S , et al. TRB3 blocks adipocyte differentiation through the inhibition of C/EBPbeta transcriptional activity[J]. Mol Cell Biol, 2007,27(19):6818-6831.
[18] Wang X, Gao L, Han Y , et al. Silicon-enhanced adipogenesis and angiogenesis for vascularized adipose tissue engineering[J]. Adv Sci (Weinh), 2018,5(11):1800776.
[19] Levi B, Longaker MT . Concise review: Adipose-derived stromal cells for skeletal regenerative medicine[J]. Stem Cells, 2011,29(4):576-582.
[20] Zhu Y, Zhang P, Gu RL , et al. Origin and clinical applications of neural crest-derived dental stem cells[J]. Chin J Dent Res, 2018,21(2):89-100.
[21] Lu Z, Yuan Y, Gao J , et al. Adipose tissue extract promotes adipose tissue regeneration in an adipose tissue engineering chamber model[J]. Cell Tissue Res, 2016,364(2):289-298.
[22] Volz AC, Huber B, Kluger PJ . Adipose-derived stem cell differentiation as a basic tool for vascularized adipose tissue engineering[J]. Differentiation, 2016,92(1/2):52-64.
[23] Gomillion CT, Burg KJ . Stem cells and adipose tissue engineering[J]. Biomaterials, 2006,27(36):6052-6063.
[24] Scott MA, Nguyen VT, Levi B , et al. Current methods of adipogenic differentiation of mesenchymal stem cells[J]. Stem Cells Dev, 2011,20(10):1793-1804.
[25] Saltiel AR . Putting the brakes on insulin signaling[J]. N Engl J Med, 2003,349(26):2560-2562.
[26] Qi L, Heredia JE, Altarejos JY , et al. TRB3 links the E3 ubi-quitin ligase COP1 to lipid metabolism[J]. Science, 2006,312(5781):1763-1766.
[27] Brazil DP, Hemmings BA . Ten years of protein kinase B signalling: A hard Akt to follow[J]. Trends Biochem Sci, 2001,26(11):657-664.
[28] Cho H, Mu J, Kim JK , et al. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta)[J]. Science, 2001,292(5522):1728-1731.
[29] Du K, Herzig S, Kulkarni RN , et al. TRB3: A tribbles homolog that inhibits Akt/PKB activation by insulin in liver[J]. Science, 2003,300(5625):1574-1577.
[30] Park JS, Kim M, Song NJ , et al. A reciprocal role of the Smad4-Taz axis in osteogenesis and adipogenesis of mesenchymal stem cells[J]. Stem Cells, 2019,37(3):368-381.
[31] Hyvari L, Ojansivu M, Juntunen M , et al. Focal adhesion kinase and ROCK signaling are switch-like regulators of human adipose stem cell differentiation towards osteogenic and adipogenic lineages[J]. Stem Cells Int, 2018, 9(2018-09-12)[2018-12-12]. .
[32] Liu X, He J, Zhang S , et al. Adipose stem cells controlled by surface chemistry[J]. J Tissue Eng Regen Med, 2013,7(2):112-117.
[33] Furuhata Y, Yoshitomi T, Kikuchi Y , et al. Osteogenic lineage commitment of adipose-derived stem cells is predetermined by three-dimensional cell accumulation on micropatterned surface[J]. ACS Appl Mater Interfaces, 2017,9(11):9339-9347.
[34] Takahashi Y, Ohoka N, Hayashi H , et al. TRB3 suppresses adipocyte differentiation by negatively regulating PPARgamma transcriptional activity[J]. J Lipid Res, 2008,49(4):880-892.
[35] Chan MC, Hilyard AC, Wu C , et al. Molecular basis for antagonism between PDGF and the TGFbeta family of signalling pathways by control of miR-24 expression[J]. EMBO J, 2010,29(3):559-573.
[36] Roy L, Bikorimana E, Lapid D , et al. MiR-24 is required for hematopoietic differentiation of mouse embryonic stem cells[J]. PLoS Genet, 2015,11(1):e1004959.
[37] Kim S, Hata A, Kang H . Down-regulation of miR-96 by bone morphogenetic protein signaling is critical for vascular smooth muscle cell phenotype modulation[J]. J Cell Biochem, 2014,115(5):889-895.
[38] Eom HJ, Chatterjee N, Lee J , et al. Integrated mRNA and micro RNA profiling reveals epigenetic mechanism of differential sensiti-vity of Jurkat T cells to AgNPs and Ag ions[J]. Toxicol Lett, 2014,229(1):311-318.
[39] Liu X, Zhao J, Liu Q , et al. MicroRNA-124 promotes hepatic triglyceride accumulation through targeting tribbles homolog 3[J]. Sci Rep, 2016,6:37170.
[1] SHUAI Ting,LIU Juan,GUO Yan-yan,JIN Chan-yuan. Knockdown of long non-coding RNA MIR4697 host gene inhibits adipogenic differentiation in bone marrow mesenchymal stem cells [J]. Journal of Peking University (Health Sciences), 2022, 54(2): 320-326.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Copyright © Journal of Peking University (Health Sciences), All Rights Reserved.
Powered by Beijing Magtech Co. Ltd