Journal of Peking University (Health Sciences) ›› 2021, Vol. 53 ›› Issue (4): 750-757. doi: 10.19723/j.issn.1671-167X.2021.04.022

Previous Articles     Next Articles

Effect of topical injection of cyclosporine A on saliva secretion and inflammation in the submandibular gland of non-obese diabetic mice

ZHU Yi-ying,MIN Sai-nan,YU Guang-yan()   

  1. Department of Oral and Maxilloficial Surgery, Peking University School and Hospital of Stomatology & National Center of Stomatology &National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
  • Received:2021-04-20 Online:2021-08-18 Published:2021-08-25
  • Contact: Guang-yan YU E-mail:gyyu@263.net
  • Supported by:
    National Natural Science Foundation of China(81671005);National Natural Science Foundation of China(81974151)

RICH HTML

  

Abstract:

Objective: To investigate the effects of topical administration of cyclosporine A (CsA) on salivary secretion and inflammation of the submandibular glands in non-obese diabetic (NOD) mice. Methods: Female NOD mice, 21 aged 14 weeks and 18 aged 21 weeks were selected and randomly divided into low-dose group, high-dose group and control group on average. CsA was injected into submandibular glands. One week later the saliva stimulated by pilocarpine was collected and measured. The submandibular glands were collected to make paraffin sections. The lymphocyte infiltration in submandi-bular gland was observed by microscope after hematoxylin-eosin (HE) staining. The number of lymphocyte infiltration foci was counted to calculate the focus sore and the ratio of lymphocyte infiltration area to total gland area was figured up by Leica image analysis system. The expressions of inflammatory cytokines tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), interleukin-4 (IL-4), IL-13, IL-17F, IL22 and IL-23a in the submandibular glands of the NOD mice were detected by quantitative real-time polymerase chain reaction (qRT-PCR). Cell apoptosis in the submandibular gland was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL). The levels of serum creatinine (Scr), blood urea nitrogen (BUN), uric acid (UA), alanine aminotransferase (ALT), aspertate aminotransferase (AST), alkaline phosphatase (ALP), albumin (ALB) and γ-glutamyl transferase (GGT) were measured by automatic biochemical analyzer to evaluate liver and kidney functions. Results: After topical injection of CsA in the submandibular gland, the stimulated salivary flow rate of the 14- and 21-week-old NOD mice significantly increased compared with the control group (P<0.01 or P<0.05), and the number and area of lymphocyte infiltration foci in the 14-week-old NOD mice low-dose group significantly decreased compared with the control group (P<0.01). Low and high dose of CsA had similar effects on reducing inflammation and improving salivary secretion. The overall level of inflammatory cytokines in the submandibular gland did not decrease significantly. The number of cell apoptosis of submandibular gland in the NOD mice treated with CsA decreased compared with the control group, but there was no statistically significant difference. Topical injection of CsA had no adverse effect on liver and kidney function in the NOD mice. Conclusion: Topical injection of CsA can reduce lymphocyte infiltration in submandibular gland of NOD mice and improve salivary secretion.

Key words: Sjögren’s syndrome, cyclosporine A, salivary gland, submandibular gland, non-obese diabetic mice

CLC Number: 

  • R782.3

Table 1

Primer sequences used for qRT-PCR"

Primer Forward primer (5'-3') Reverse primer (5'-3')
TNF-α CCTGTAGCCCACGTCGTAG GGGAGTAGACAAGGTACAACCC
IFN-γ CTCAAGTGGCATAGATGTGGAAG TGACCTCAAACTTGGCAATACTC
IL-4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT
IL-13 CCTGGCTCTTGCTTGCCTT GGTCTTGTGTGATGTTGCTCA
IL-17F TGCTACTGTTGATGTTGGGAC AATGCCCTGGTTTTGGTTGAA
IL-22 ATGAGTTTTTCCCTTATGGGGAC GCTGGAAGTTGGACACCTCAA
IL-23a AACTCCTCCAGCCAAGGATCA TCTTGGAACGGAGAGGGGG
GAPDH CTTTGGCATTGTGGAAGGGCTC GCAGGGATGATGTTCTGGGCAG

Figure 1

Variation in the stimulated saliva flow rate of NOD mice * P<0.05, # P<0.01, vs. control group; 14 weeks (n=7), 21 weeks (n=6)."

Figure 2

Histopathological changes of the submandibular glands of 14 weeks and 21 weeks NOD mice A, HE staining of 14 weeks NOD mice; B, HE staining of 21 weeks NOD mice; C, FS of submandibular glands; D, the ratio index representing the ratio of the lymphocytic foci area to the total area of glandular tissue. Control, the control group; Low, the low dose group; High, the high dose group; FS, focus score. 14 weeks (n = 7), 21 weeks (n = 6), *P<0.05, # P<0.01, vs. control group."

Figure 3

Cell apoptosis in the submandibular gland of 14 weeks and 21 weeks NOD mice A, TUNEL and DAPI staining of 14 weeks NOD mice; B, TUNEL and DAPI staining of 21 weeks NOD mice; C, percentage of apoptotic cells. TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling; DAPI, 4’, 6-diamidino-2-phenylindole. Control, the control group; Low, the low dose group; High, the high dose group. 14 weeks (n = 7), 21 weeks (n = 6), P > 0.05 vs. control group."

Figure 4

Levels of cytokines in the submandibular gland of 14 weeks and 21 weeks NOD mice A, 14 weeks (n = 7); B, 21 weeks (n = 6); * P < 0.05, # P < 0.01, vs. control group. TNF-α, tumor necrosis factor α; IFN-γ, interferon γ; IL-4, interleukin 4; IL-13, interleukin 13; IL-17F interleukin 17F; IL-22 interleukin 22; IL-23a, interleukin 23a."

Table 2

NOD mice liver and renal function"

Groups UA/(μmoL/L) BUN/(mmoL/L) Scr/(μmoL/L) ALT/(U/L) AST/(U/L) GGT/(U/L) ALP/(U/L) ALB/(g/L)
14 weeks NOD mice (n=7), $\bar{x}±s$
Control 116.00±6.13 9.56±0.48 53.16±5.01 73.17±4.64 96.09±5.06 2.25±0.41 1.94±0.66 30.55±0.77
Low 110.26±10.60 9.96±0.65 52.20±5.27 72.98±5.31 97.20±7.44 1.80±0.34 1.64±0.78 25.56±0.31
High 119.36±10.14 10.60±0.54 55.51±6.98 79.19±2.56 99.72±2.56 1.03±0.31 1.84±0.94 29.20±0.92
21 weeks NOD mice (n=6), $\bar{x}±s$
Control 148.68±14.15 10.69±0.35 62.03±12.71 99.31±10.2 124.95±16.85 0.96±0.26 1.66±1.04 30.80±0.66
Low 128.88±0.92 9.35±0.57 51.39±5.98 85.74±3.36 112.92±7.17 1.27±0.39 0.73±0.27 30.14±0.54
High 133.70±12.30 10.44±0.41 56.32±6.62 91.04±5.72 121.06±11.13 1.41±0.31 1.82±0.77 30.20±0.51
[1] Ramos-Casals M, Tzioufas AG, Stone JH, et al. Treatment of primary Sjögren syndrome: a systematic review [J]. JAMA, 2010, 304(4):452-460.
doi: 10.1001/jama.2010.1014 pmid: 20664046
[2] Saraux A, Pers JO, Devauchelle-Pensec V. Treatment of primary Sjögren syndrome [J]. Nat Rev Rheumatol, 2016, 12(8):456-471.
doi: 10.1038/nrrheum.2016.100 pmid: 27411907
[3] 苏运超, 吴立玲, 向若兰. 舍格伦综合征发病机制的实验研究 [J]. 生理科学进展, 2012, 43(3):13-18.
[4] Scuron MD, Fay B, Oliver J, et al. Spontaneous model of Sjögren’s syndrome in NOD mice [J]. Cur protoc pharmacol, 2019, 86(1):e65.
[5] Lallemand F, Schmitt M, Bourges JL, et al. Cyclosporine A delivery to the eye: A comprehensive review of academic and industrial efforts [J]. Eur J Pharm Biopharm, 2017, 117:14-28.
doi: S0939-6411(16)30908-0 pmid: 28315447
[6] Chighizola CB, Ong VH, Meroni PL. The use of cyclosporine A in rheumatology: A 2016 comprehensive review [J]. Clin Rev Allergy Immunol, 2017, 52(3):401-423.
doi: 10.1007/s12016-016-8582-3
[7] Brito-Zerón P, Retamozo S, Kostov B, et al. Efficacy and safety of topical and systemic medications: A systematic literature review informing the EULAR recommendations for the management of Sjögren’s syndrome [J]. RMD Open, 2019, 5(2):e001064.
doi: 10.1136/rmdopen-2019-001064
[8] Guo YF, Sun NN, Wu CB, et al. Sialendoscopy-assisted treatment for chronic obstructive parotitis related to Sjögren’s syndrome [J]. Oral Surg Oral Med Oral Pathol Oral Radiol, 2017, 123(3):305-309.
doi: 10.1016/j.oooo.2016.10.011
[9] Nagy C, Einwallner E. Study of in vivo glucose metabolism in high-fat diet-fed mice using oral glucose tolerance test (OGTT) and insulin tolerance test (ITT) [J]. J Vis Exp, 2018(131):56672.
[10] Borg DJ, Wang R, Murray L, et al. The effect of interleukin-22 treatment on autoimmune diabetes in the NOD mouse [J]. Diabetologia, 2017, 60(11):2256-2261.
doi: 10.1007/s00125-017-4392-2
[11] Kawai K, Watabe S, Matsuda M, et al. Correlation between expression of orotate phosphoribosyl transferase and 5-fluorouracil sensitivity, as measured by apoptosis index in colorectal cancer tissue [J]. Int J Gastrointest Cancer, 2005, 35(3):197-203.
pmid: 16110121
[12] Shiboski CH, Shiboski SC, Seror R, et al. 2016 American College of Rheumatology/European League Against Rheumatism classification criteria for primary Sjögren’s syndrome: A consensus and data-driven methodology involving three international patient cohorts [J]. Arthritis Rheumatol, 2017, 69(1):35-45.
doi: 10.1002/art.v69.1
[13] Navarro-Mendoza EP, Aguirre-Valencia D, Posso-Osorio I, et al. Cytokine markers of B lymphocytes in minor salivary gland infiltrates in Sjögren’s syndrome [J]. Autoimmun Rev, 2018, 17(7):709-714.
doi: S1568-9972(18)30112-5 pmid: 29729452
[14] Reff ME, Carner K, Chambers S, et al. Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20 [J]. Blood, 1994, 83(2):435-445.
pmid: 7506951
[15] Blokland SCV, Versnel MA. Pathogenesis of Sjgren’s syndrome: Characteristics of different mouse models for autoimmune exocrinopathy [J]. Clin Immunol, 2002, 103(2):111-124.
pmid: 12027416
[16] Lavoie TN, Lee BH, Nguyen CQ. Current concepts: mouse models of Sjögren’s syndrome[J/OL]. J Biomed Biotechnol, 2011: 549107. (2010-12-30)[2020-10-30]. https://pubmed.ncbi.nlm.nih.gov/21253584 .
[17] Faulds D, Goa KL, Benfield P. Cyclosporin. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic use in immunoregulatory disorders [J]. Drugs, 1993, 45(6):953-1040.
doi: 10.2165/00003495-199345060-00007 pmid: 7691501
[18] Graham RM. Cyclosporine: mechanisms of action and toxicity [J]. Cleve Clin J Med, 1994, 61(4):308-313.
doi: 10.3949/ccjm.61.4.308
[19] United States Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation and Research (CDER). Guidance for industry: estimating the maximum safe starting dose in initial clinical trials for therapeutics in adult healthy volunteers[EB/OL]. (2005-07-06)[2020-2-19].https://www.fda.gov/regulatory-information/search-fda-guidance-documents/estimating-maximum-safe-starting-dose-initial-clinical-trials-therapeutics-adult-healthy-volunteers .
[20] Daull P, Barabino S, Feraille L, et al. Modulation of inflammation-related genes in the cornea of a mouse model of dry eye upon treatment with cyclosporine eye drops [J]. Curr Eye Res, 2019, 44(5):476-485.
doi: 10.1080/02713683.2018.1563197
[21] Zhang FD, Hao ZQ, Gao W, et al. Effect of topical 0.05% cyclosporine A on the tear protein lacritin in a rat model of dry eye [J]. Int J Ophthalmol, 2019, 12(2):189-193.
[1] Jing YANG, Xiaoyun XU, Danni ZHENG, Xiaotong LING, Liuyang QU, Denggao LIU. Clinical and imaging characteristics and etiology of 544 cases with chronic sialadenitis [J]. Journal of Peking University (Health Sciences), 2026, 58(3): 650-657.
[2] Xin CONG, Jiazeng SU, Liling WU, Chong DING, Wei LI, Guangyan YU. Research progress in diagnosis and treatment of non-tumorous salivary gland diseases [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 1-9.
[3] Yuting YANG, Liuyang QU, Danni ZHENG, Xiaotong LING, Xiaoyun XU, Denggao LIU. Demographic characteristic and clinical features in 1 812 patients with salivary gland stones [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 153-159.
[4] Yuanyuan YANG, Shanshan ZHANG, Guangyan YU, Huijun YANG, Hongyu YANG. Clinical outcomes of partial sialoadenectomy for the treatment of benign tumors in the submandibular gland [J]. Journal of Peking University (Health Sciences), 2025, 57(2): 334-339.
[5] Guangyan YU, Xin PENG, Min GAO, Peng YE, Na GE, Mengqi JIA, Bingyu LI, Zunan TANG, Leihao HU, Wenbo ZHANG. Research progress in diagnosis and treatment of salivary gland tumors [J]. Journal of Peking University (Health Sciences), 2025, 57(1): 1-6.
[6] Yushu YANG, Xuan QI, Meng DING, Wei WANG, Huifang GUO, Lixia GAO. Diagnostic values of anti-salivary gland protein-1 antibody combined with anti-parotid secretory protein antibody for Sjögren's syndrome [J]. Journal of Peking University (Health Sciences), 2024, 56(5): 845-852.
[7] Deng-gao LIU,Dan-ni ZHENG,Ya-ning ZHAO,Ya-qiong ZHANG,Xin YE,Li-qi ZHANG,Xiao-yan XIE,Lei ZHANG,Zu-yan ZHANG,Guang-yan YU. Recent progress in the treatment of intractable sialolithiasis [J]. Journal of Peking University (Health Sciences), 2023, 55(1): 8-12.
[8] Yang LIU,Fang CHENG,Yan-ling WANG,Xiang-yan AI,Zhen-hang ZHU,Fu-tao ZHAO. Diagnostic performances of salivary gland ultrasonography for Sjögren's syndrome [J]. Journal of Peking University (Health Sciences), 2022, 54(6): 1123-1127.
[9] Guang-yan YU,Jia-zeng SU,Deng-gao LIU,Li-ling WU,Xin CONG. Establishment and application of new techniques for submandibular gland preservation [J]. Journal of Peking University (Health Sciences), 2022, 54(5): 842-845.
[10] CHEN Chao-lun,SU Jia-zeng,YU Guang-yan. Effects of acid stimulation on saliva flow rate and compositions of human parotid and submandibular glands [J]. Journal of Peking University (Health Sciences), 2022, 54(1): 89-94.
[11] YU Guang-yan,LIU Deng-gao,LI Wei,HONG Xia,ZHANG Yan-yan,ZHU Wen-xuan,ZHANG Ke-fu,LI Xiao,LI Zhan-guo,LIU Yan-ying,CHEN Yan,GAO Yan,SU Jia-zeng. Studies on newly recognized chronic sialadenitis [J]. Journal of Peking University (Health Sciences), 2022, 54(1): 13-17.
[12] WANG Yi-ping,CAI Zhi-gang,PENG Xin,ZHANG Jie,SUN Zhi-peng,LI Wei,ZHANG Lei,YU Guang-yan. Measurement of the weight and volume of submandibular gland in vitro [J]. Journal of Peking University (Health Sciences), 2021, 53(1): 126-132.
[13] Huan-bin YU,Wen-jie WU,Xiao-ming LV,Yan SHI,Lei ZHENG,Jian-guo ZHANG. 125I seed brachytherapy for recurrent salivary gland carcinoma after external radiotherapy [J]. Journal of Peking University (Health Sciences), 2020, 52(5): 919-923.
[14] Ye ZHANG,Ni ZHANG,Xiao-xiao LIU,Chuan-xiang ZHOU. Cervical lymph node metastasis in adenoid cystic carcinoma of the salivary glands: A clinicopathologic study [J]. Journal of Peking University(Health Sciences), 2020, 52(1): 30-34.
[15] Xin CONG,Sai-nan MIN,Li-ling WU,Zhi-gang CAI,Guang-yan YU. Role and mechanism of muscarinic acetylcholine receptor in the regulation of submandibular gland secretion [J]. Journal of Peking University(Health Sciences), 2019, 51(3): 390-396.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!