Email Alert | RSS

Journal of Peking University (Health Sciences) ›› 2024, Vol. 56 ›› Issue (3): 495-504. doi: 10.19723/j.issn.1671-167X.2024.03.017

Previous Articles     Next Articles

Role and mechanism of cysteine and glycine-rich protein 2 in the malignant progression of neuroblastoma

Yao ZHANG,Jinxin GUO,Shijia ZHAN,Enyu HONG,Hui YANG,Anna JIA,Yan CHANG,Yongli GUO,Xuan ZHANG*()   

  1. National Center for Children's Health; Beijing Children's Hospital, Capital Medical University; Key Laboratory of Major Diseases in Children, Ministry of Education; Beijing Pediatric Research Institute; Beijing Key Laboratory for Pediatric Diseases of Otolaryngology, Head and Neck Surgery; Beijing 100045, China
  • Received:2023-11-30 Online:2024-06-18 Published:2024-06-12
  • Contact: Xuan ZHANG E-mail:x_zhang1992@163.com
  • Supported by:
    the Beijing Natural Science Foundation(7244341);the Research and Development Program of Beijing Municipal Education Commission(KM202210025010);the Beijing Hospitals Authority Clinical Medicine Development of Special Funding Support(XMLX202121);the National Natural Science Foundation of China(82293660);the National Natural Science Foundation of China(82293665);the National Natural Science Foundation of China(82141118);the National Natural Science Foundation of China(82172849)

RICH HTML

   

PDF (PC)

Abstract:

Objective: To investigate the function and underlying mechanism of cysteine and glycine-rich protein 2 (CSRP2) in neuroblastoma (NB). Methods: The correlation between the expression level of CSRP2 mRNA and the prognosis of NB children in NB clinical samples was analyzed in R2 Genomics Analysis and Visualization Platform. The small interfering RNA (siRNA) targeting CSRP2 or CSRP2 plasmid were transfected to NB cell lines SK-N-BE(2) and SH-SY5Y. Cell proliferation was observed by crystal violet staining and real-time cellular analysis. The ability of colony formation of NB cells was observed by colony-forming unit assay. Immunofluorescence assay was used to detect the expression of the proliferation marker Ki-67. Flow cytometry analysis for cell cycle proportion was used with cells stained by propidium iodide (PI). Annexin V/7AAD was used to stain cells and analyze the percentage of cell apoptosis. The ability of cell migration was determined by cell wound-healing assay. The level of protein and mRNA expression of CSRP2 in NB primary tumor and NB cell lines were detected by Western blot and quantitative real-time PCR (RT-qPCR). Results: By analyzing the NB clinical sample databases, it was found that the expression levels of CSRP2 in high-risk NB with 3/4 stages in international neuroblastoma staging system (INSS) were significantly higher than that in low-risk NB with 1/2 INSS stages. The NB patients with high expression levels of CSRP2 were shown lower overall survival rate than those with low expression levels of CSRP2. We detected the protein levels of CSRP2 in the NB samples by Western blot, and found that the protein level of CSRP2 in 3/4 INSS stages was significantly higher than that in 1/2 INSS stages. Knockdown of CSRP2 inhibited cell viability and proliferation of NB cells. Overexpression of CSRP2 increased the proliferation of NB cells. Flow cytometry showed that the proportion of sub-G1, G0/G1 and S phase cells and Annexin V positive cells were increased after CSRP2 deficiency. In the cell wound-healing assay, the healing rate of NB cells was significantly attenuated after knockdown of CSRP2. Further mechanism studies showed that the proportion of the proliferation marker Ki-67 and the phosphorylation levels of extracellular signal-regulated kinases 1/2 (ERK1/2) were significantly decreased after CSRP2 knockdown. Conclusion: CSRP2 is highly expressed in high-risk NB with 3/4 INSS stages, and the expression levels of CSRP2 are negatively correlated with the overall survival of NB patients. CSRP2 significantly increased the proliferation and cell migration of NB cells and inhibited cell apoptosis via the activation of ERK1/2. All these results indicate that CSRP2 promotes the progression of NB by activating ERK1/2, and this study will provide a potential target for high-risk NB therapy.

Key words: Cysteine and glycine-rich protein 2, Neuroblastoma, Cell proliferation, Cell migration, Extracellular signal-regulated kinase 1/2

CLC Number: 

  • R739.4

Table 1

Clinical characteristics of pediatric patients with NB"

Case no. Gender Age at diagnosis/years Primary tumor site INSS stage Prognosis Date of last follow-up
1 Female 0.4 Retroperitoneal 1 Survival 2019.12.18
2 Female 5.2 Adrenal 1 Survival 2019.12.20
3 Male 1.0 Adrenal 2 Survival 2019.12.18
4 Female 3.9 Neck 3 Survival 2019.12.18
5 Female 1.2 Adrenal 3 Survival 2019.12.18
6 Male 5.5 Adrenal 4 Survival 2019.12.18
7 Female 5.2 Retroperitoneal 4 Survival 2019.12.18
8 Female 8.7 Adrenal 4 Survival 2019.12.18

Table 2

The sequences of small interfering RNA"

Name of siRNA Sense (5′-3′)
Human-siCSRP2-1# GAAGAGATCTACTGCAAAT
Human-siCSRP2-2# GCACAACAGTGGCAATTCA

Table 3

Primers of target genes"

Gene name Primer sequence (5′-3′) Product length/bp
CSRP2 Forward: TGGGAGGACCGTGTACCAC 177
Reverse: CCGTAGCCTTTTGGCCCATA
GAPDH Forward: GAGTCAACGGATTTGGTCGT 238
Reverse: TTGATTTTGGAGGGATCTCG

Figure 1

Correlations of the expression levels of CSRP2 with INSS stages and overall survival probability in different NB clinical samples A, expression levels of CSRP2 mRNA in INSS stages in Versteeg-88 NB database (GSE16476). B, Kaplan-Meier analysis of NB overall survival probability and CSRP2 expression correlation (Versteeg-88, GSE16476 database). C, expression levels of CSRP2 mRNA in INSS stages in SEQC-498 NB database (GSE49710). D, Kaplan-Meier analysis of NB overall survival probability and CSRP2 expression correlation (SEQC-498, GSE49710 database). E, expression levels of CSRP2 mRNA in INSS stages in Westermann-144 NB database. F, Kaplan-Meier analysis of NB overall survival probability and CSRP2 expression correlation (Westermann-144 database). G, expression levels of CSRP2 mRNA in INSS stages in Kocak-649 NB database (GSE45547). H, Kaplan-Meier analysis of NB overall survival probability and CSRP2 expression correlation (Kocak-649, GSE45547 database); Cutoff mode: median. I, immunoblotting analysis of CSRP2 in NB samples of different INSS stages. J, quantification of relative protein levels of CSRP2 in Figure I. High: high CSRP2 expression group; Low: low CSRP2 expression group. CSRP2, cysteine and glycine-rich protein 2; INSS, international neuroblastoma staging system; NB, neuroblastoma."

Figure 2

Effect of knockdown of CSRP2 on cell viability and colony formation ability of two NB cell lines SK-N-BE(2) and SH-SY5Y A, immunoblotting analysis of CSRP2 in MYCN-amplified NB cell lines and MYCN-unamplified NB cell lines. B, quantification of relative protein levels of CSRP2 in Figure A. C, mRNA expression levels of CSRP2 in SK-N-BE(2) cells and SH-SY5Y cells after siRNA transfection at 24 h, 48 h, and 72 h by RT-qPCR ($\bar x \pm s$, n=3, *** P<0.001). D, SK-N-BE(2) cells transfected with siRNA for 72 h were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet for 30 min at room temperature. Bright field and crystal violet staining images were shown (×100). E, RTCA monitoring of SK-N-BE(2) after siRNA transfection for 60 h (*** P<0.001). F, colony formation of SK-N-BE(2) on the 14th day after siRNA transfection (** P<0.01). G, bright field and crystal violet staining images of SH-SY5Y cells were shown (methods were the same as D, ×100). H, RTCA monitoring of SH-SY5Y after siRNA transfection for 60 h (*** P<0.001). I, colony formation of SH-SY5Y on the 14th day after siRNA transfection (** P<0.01, *** P<0.001). siCtrl, siRNA targeting luciferase reporter control; siCSRP2-1#, number 1 siRNA targeting human CSRP2; siCSRP2-2#, number 2 siRNA targeting human CSRP2; CSRP2, cysteine and glycine-rich protein 2; NB, neuroblastoma; siRNA, small interfering RNA; RT-qPCR, quantitative real-time PCR; RTCA, real time xCELLigence analysis system."

Figure 3

Proliferation ability of NB cell lines after overexpression of CSRP2 A, SK-N-BE(2) cells transfected with plasmids for 96 h were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet for 30 min at room temperature. Bright field and crystal violet staining images were shown (×100). B, immunoblotting analysis of Flag-CSRP2 and GAPDH in SK-N-BE(2) cells after plasmid transfection. C, RTCA monitoring of SK-N-BE(2) after plasmid transfection for 120 h (** P<0.01, *** P<0.001). D, bright field and crystal violet staining images of SH-SY5Y cells were shown (methods were the same as A, ×100). E, immunoblotting analysis of Flag-CSRP2 and GAPDH in SH-SY5Y cells after plasmid transfection. F, RTCA monitoring of SH-SY5Y after plasmid transfection for 120 h (*** P<0.001). CSRP2, cysteine and glycine-rich protein 2; NB, neuroblastoma; RTCA, real time xCELLigence analysis system."

Figure 4

Effects of knockdown of CSRP2 on the percentage of cell cycle, Ki-67 level and apoptosis ratio of SK-N-BE(2) cells A, the relative level of cells in every stage of cell cycle in SK-N-BE(2) cells after siRNA transfection by flow cytometry. B, Ki-67 expression in SK-N-BE(2) cells after siRNA transfection for 72 h by immunofluorescence assay. SK-N-BE(2) cells transfected with siRNA were fixed with 4% paraformaldehyde, incubated in 0.3% Triton X-100 for 10 min, and blocked with 5% bovine serum albumin. Cells were incubated with anti-Ki67 antibody conjugated with FITC. Nucleus was stained with Hoechst33342 (×600, ** P<0.01). C, the relative level of apoptotic SK-N-BE(2) cells after siRNA transfection for 72 h by flow cytometry (*** P<0.001). siCtrl, siRNA targeting luciferase reporter control; siCSRP2-1#, number 1 siRNA targeting human CSRP2; siCSRP2-2#, number 2 siRNA targeting human CSRP2; CSRP2, cysteine and glycine-rich protein 2."

Figure 5

Effect of knockdown of CSRP2 on the wound closure in NB cell lines A, representative images of scratch wound assay in SK-N-BE(2) cells, the yellow line means scratch, and the wound closure was analyzed at 24 h and 48 h (* P<0.05, ** P<0.01); B, representative images of scratch wound assay in SH-SY5Y cells, the yellow line means scratch, and the wound closure was analyzed at 24 h and 48 h (* P<0.05, ** P<0.01, *** P<0.001). siCtrl, siRNA targeting luciferase reporter control; siCSRP2-1#, number 1 siRNA targeting human CSRP2; siCSRP2-2#, number 2 siRNA targeting human CSRP2; CSRP2, cysteine and glycine-rich protein 2; NB, neuroblastoma."

Figure 6

Effect of knockdown of CSRP2 on the protein levels of p-ERK1/2 and ERK1/2 in NB cells lines A, immunoblotting analysis and quantification of Ki-67, p-ERK1/2, ERK1/2, and CSRP2 in SK-N-BE(2) cells after siRNA transfection for 72 h. B, immunoblotting analysis and quantification of Ki-67, p-ERK1/2, ERK1/2, and CSRP2 in SH-SY5Y cells after siRNA transfection for 72 h. siCtrl, siRNA targeting luciferase reporter control; siCSRP2-1#, number 1 siRNA targeting human CSRP2; siCSRP2-2#, number 2 siRNA targeting human CSRP2; CSRP2, cysteine and glycine-rich protein 2; NB, neuroblastoma; ERK1/2, extracellular signal-regulated kinases 1/2; p-ERK1/2, phosphorylated extracellular signal-regulated kinases 1/2; siRNA, small interfering RNA."

1 Anderson J , Majzner RG , Sondel PM . Immunotherapy of neuroblastoma: Facts and hopes[J]. Clin Cancer Res, 2022, 28 (15): 3196- 3206.
doi: 10.1158/1078-0432.CCR-21-1356
2 Zafar A , Wang W , Liu G , et al. Molecular targeting therapies for neuroblastoma: Progress and challenges[J]. Med Res Rev, 2020, 41 (2): 961- 1021.
3 Su Y , Qin H , Chen C , et al. Treatment and outcomes of 1041 pediatric patients with neuroblastoma who received multidisciplinary care in China[J]. Pediatr Investig, 2020, 4 (3): 157- 167.
doi: 10.1002/ped4.12214
4 Sainero-Alcolado L , Mushtaq M , Liano-Pons J , et al. Expression and activation of nuclear hormone receptors result in neuronal differentiation and favorable prognosis in neuroblastoma[J]. J Exp Clin Cancer Res, 2022, 41 (1): 226.
doi: 10.1186/s13046-022-02399-x
5 Maris JM . Recent advances in neuroblastoma[J]. N Engl J Med, 2010, 362 (23): 2202- 2211.
doi: 10.1056/NEJMra0804577
6 Jain MK , Kashiki S , Hsieh CM , et al. Embryonic expression suggests an important role for CRP2/SmLIM in the developing cardiovascular system[J]. Circ Res, 1998, 83 (10): 980- 985.
doi: 10.1161/01.RES.83.10.980
7 Sala S , Oakes PW . LIM domain proteins[J]. Curr Biol, 2023, 33 (9): R339- R341.
doi: 10.1016/j.cub.2023.03.030
8 Chen L , Long X , Duan S , et al. CSRP2 suppresses colorectal cancer progression via p130Cas/Rac1 axis-meditated ERK, PAK, and HIPPO signaling pathways[J]. Theranostics, 2020, 10 (24): 11063- 11079.
doi: 10.7150/thno.45674
9 Wang SJ , Wang PZ , Gale RP , et al. Cysteine and glycine-rich protein 2 (CSRP2) transcript levels correlate with leukemia relapse and leukemia-free survival in adults with B-cell acute lymphoblastic leukemia and normal cytogenetics[J]. Oncotarget, 2017, 8 (22): 35984- 36000.
doi: 10.18632/oncotarget.16416
10 Wang S , Zhang Y , Liu Y , et al. Inhibition of CSRP2 promotes leukemia cell proliferation and correlates with relapse in adults with acute myeloid leukemia[J]. Onco Targets Ther, 2020, 13, 12549- 12560.
doi: 10.2147/OTT.S281802
11 Hoffmann C , Mao X , Brown-Clay J , et al. Hypoxia promotes breast cancer cell invasion through HIF-1α-mediated up-regulation of the invadopodial actin bundling protein CSRP2[J]. Sci Rep, 2018, 8 (1): 10191.
doi: 10.1038/s41598-018-28637-x
12 Bansal D , Totadri S , Chinnaswamy G , et al. Management of neuroblastoma: ICMR consensus document[J]. Indian J Pediatr, 2017, 84 (6): 446- 455.
doi: 10.1007/s12098-017-2298-0
13 Guo YJ , Pan WW , Liu SB , et al. ERK/MAPK signalling pathway and tumorigenesis[J]. Exp Ther Med, 2020, 19 (3): 1997- 2007.
14 Flynn SM , Lesperance J , Macias A , et al. The multikinase inhi-bitor RXDX-105 is effective against neuroblastoma in vitro and in vivo[J]. Oncotarget, 2019, 10 (59): 6323- 6333.
doi: 10.18632/oncotarget.27259
15 Janssen M , Schmidt C , Bruch PM , et al. Venetoclax synergizes with gilteritinib in FLT3 wild-type high-risk acute myeloid leukemia by suppressing MCL-1[J]. Blood, 2022, 140 (24): 2594- 2610.
doi: 10.1182/blood.2021014241
16 Chen L , Willis SN , Wei A , et al. Differential targeting of prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary apoptotic function[J]. Mol Cell, 2005, 17 (3): 393- 403.
doi: 10.1016/j.molcel.2004.12.030
17 Mendoza MC , Vilela M , Juarez JE , et al. ERK reinforces actin polymerization to power persistent edge protrusion during motility[J]. Sci Signal, 2015, 8 (377): ra47.
18 Hohmann T , Dehghani F . The cytoskeleton: A complex interacting meshwork[J]. Cells, 2019, 8 (4): 362.
doi: 10.3390/cells8040362
19 Hayashi KI , Horoiwa S , Mori K , et al. Role of CRP2-MRTF interaction in functions of myofibroblasts[J]. Cell Struct Funct, 2023, 48 (1): 83- 98.
doi: 10.1247/csf.23004
20 Chen CH , Ho HH , Jiang WC , et al. Cysteine-rich protein 2 deficiency attenuates angiotensin Ⅱ-induced abdominal aortic aneurysm formation in mice[J]. J Biomed Sci, 2022, 29 (1): 25.
doi: 10.1186/s12929-022-00808-z
21 Grubinger M , Gimona M . CRP2 is an autonomous actin-binding protein[J]. FEBS Lett, 2004, 557 (1/2/3): 88- 92.
22 Moreno L , Barone G , Dubois SG , et al. Accelerating drug deve-lopment for neuroblastoma: Summary of the Second Neuroblastoma Drug Development Strategy forum from Innovative Therapies for Children with Cancer and International Society of Paediatric Onco-logy Europe Neuroblastoma[J]. Eur J Cancer, 2020, 136, 52- 68.
doi: 10.1016/j.ejca.2020.05.010
23 Wienke J , Dierselhuis MP , Tytgat GAM , et al. The immune landscape of neuroblastoma: Challenges and opportunities for novel therapeutic strategies in pediatric oncology[J]. Eur J Cancer, 2021, 144, 123- 150.
doi: 10.1016/j.ejca.2020.11.014
24 Wang L , Chen C , Song Z , et al. EZH2 depletion potentiates MYC degradation inhibiting neuroblastoma and small cell carcinoma tumor formation[J]. Nat Commun, 2022, 13 (1): 12.
doi: 10.1038/s41467-021-27609-6
25 Chen L , Alexe G , Dharia NV , et al. CRISPR-Cas9 screen reveals a MYCN-amplified neuroblastoma dependency on EZH2[J]. J Clin Invest, 2018, 128 (1): 446- 462.
26 Pacenta HL , Macy ME . Entrectinib and other ALK/TRK inhibitors for the treatment of neuroblastoma[J]. Drug Des Devel Ther, 2018, 12, 3549- 3561.
doi: 10.2147/DDDT.S147384
27 Temple WC , Vo KT , Matthay KK , et al. Association of image-defined risk factors with clinical features, histopathology, and outcomes in neuroblastoma[J]. Cancer Med, 2021, 10 (7): 2232- 2241.
doi: 10.1002/cam4.3663
28 Mina M , Boldrini R , Citti A , et al. Tumor-infiltrating T lymphocytes improve clinical outcome of therapy-resistant neuroblastoma[J]. Oncoimmunology, 2015, 4 (9): e1019981.
doi: 10.1080/2162402X.2015.1019981
29 Maerken TV , Speleman F , Vermeulen J , et al. Small-molecule MDM2 antagonists as a new therapy concept for neuroblastoma[J]. Cancer Res, 2006, 66 (19): 9646- 9655.
doi: 10.1158/0008-5472.CAN-06-0792
30 Xue C , Haber M , Flemming C , et al. p53 determines multidrug sensitivity of childhood neuroblastoma[J]. Cancer Res, 2007, 67 (21): 10351- 10360.
doi: 10.1158/0008-5472.CAN-06-4345
31 Greengard EG . Molecularly targeted therapy for neuroblastoma[J]. Children (Basel), 2018, 5 (10): 142.
[1] Jing XIE,Yu-ming ZHAO,Nan-quan RAO,Xiao-tong WANG,Teng-jiao-zi FANG,Xiao-xia LI,Yue ZHAI,Jing-zhi LI,Li-hong GE,Yuan-yuan WANG. Comparative study of differentiation potential of mesenchymal stem cells derived from orofacial system into vascular endothelial cells [J]. Journal of Peking University(Health Sciences), 2019, 51(5): 900-906.
[2] TANG Xu, ZHAO Wei-hong, SONG Qin-qin, YIN Hua-qi, DU Yi-qing, SHENG Zheng-zuo, WANG Qiang, ZHANG Xiao-wei, LI Qing, LIU Shi-jun, XU Tao. Influence of SOX10 on the proliferation and invasion of prostate cancer cells [J]. Journal of Peking University(Health Sciences), 2018, 50(4): 602-606.
[3] WANG Zi-cheng, CHENG Li, LV Tong-de, SU Li, LIN Jian, ZHOU Li-qun. Inflammatory priming adipose derived stem cells significantly inhibit the proliferation of peripheral blood mononuclear cells [J]. Journal of Peking University(Health Sciences), 2018, 50(4): 590-594.
[4] CHEN Wei, HU Fan-lei, LIU Hong-jiang, XU Li-ling, LI Ying-ni, LI Zhan-guo. Myeloid-derived suppressor cells promoted autologous B cell proliferation in rheumatoid arthritis [J]. Journal of Peking University(Health Sciences), 2017, 49(5): 819-823.
[5] CAI Yi, GUO Hao, LI Han-zhong, WANG Wen-da, ZHANG Yu-shi. MicroRNA differential expression profile in tuberous sclerosis complex cell line TSC2-/- MEFs and normal cell line TSC2+/+ MEFs [J]. Journal of Peking University(Health Sciences), 2017, 49(4): 580-584.
[6] SIMA Zi-han, HONG Ying-ying, LI Tie-jun△. Effects of PTCH1 mutations on the epithelial proliferation derived from keratocystic odontogenic tumour [J]. Journal of Peking University(Health Sciences), 2017, 49(3): 522-526.
[7] GAO Xiang, CHEN Xiang-mei, ZHANG Ting, ZHANG Jing, CHEN Mo, GUO Zheng--yang, SHI Yan-yan, LU Feng-min, DING Shi-gang. Relationship between macrophage capping protein and gastric cancer cell’s proliferation and migration ability [J]. Journal of Peking University(Health Sciences), 2017, 49(3): 489-494.
[8] YANG Di, XU Jun-hui, DENG Fu-rong△, GUO Xin-biao . Effects of silver nanoparticle on hemichannel activation and anti-proliferation in HaCaT cells [J]. Journal of Peking University(Health Sciences), 2017, 49(3): 371-375.
[9] SUI Hua-xin, LV Pei-jun, WANG Yu-guang, WANG Yong, SUN Yu-chun. Effect of lowlevel laser irradiation on proliferation and osteogenic differentiation of human adipose-derived stromal cells [J]. Journal of Peking University(Health Sciences), 2017, 49(2): 337-343.
[10] LI Jing-wen, YIN Xiao-hui， LUAN Qing-xian. Comparative study of proliferative and periodontal differentiation propensity of induced pluripotent stem cells at different passages [J]. Journal of Peking University(Health Sciences), 2017, 49(1): 16-024.
[11] LING Long, ZHAO Yu-ming, GE Li-hong. Impact of different degree pulpitis on cell proliferation and osteoblastic differentiation of dental pulp stem cell in Beagle immature premolars [J]. Journal of Peking University(Health Sciences), 2016, 48(5): 878-883.
[12] HU Jia，ZOU Xiao-ying，ZHUANG Heng，GAO Xue-jun. Effect of root canal sealers on biocompatibility of human periodontal ligament cells [J]. Journal of Peking University(Health Sciences), 2016, 48(5): 871-877.
[13] HU Feng-zhan, YUAN Wan-qiong, WANG Xiao-lin, QIN Cai-peng, SHENG Zheng-zuo, DU Yi-qing, YIN Hua-qi, XU Tao. Knockdown of CMTM3 promotes migration and invasion of PC3 cell in vitro [J]. Journal of Peking University(Health Sciences), 2016, 48(4): 594-597.
[14] MO Heng, GAO Cheng-zhi, WANG Shao-jie, LI Mei, DONG Jian-qiang,YU Wei-dong . Expression, roles and therapy target values of CD24 in oral squamous cell carcinoma [J]. Journal of Peking University(Health Sciences), 2016, 48(1): 16-22.
[15] WANG Xiao-fei, LV Pei-jun, SONG Yang, WANG Yong, SUN Yu-chun. Short-term effect of CaCl2 on human adipose-derived mesenchymal stem cells proliferation and osteogenic differentiation [J]. Journal of Peking University(Health Sciences), 2015, 47(6): 971-976.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Copyright © Journal of Peking University (Health Sciences), All Rights Reserved.
Powered by Beijing Magtech Co. Ltd