Journal of Peking University (Health Sciences) ›› 2025, Vol. 57 ›› Issue (1): 7-12. doi: 10.19723/j.issn.1671-167X.2025.01.002

Previous Articles     Next Articles

Knockdown of NPTX1 promotes osteogenic differentiation of human bone marrow mesenchymal stem cells

Ting SHUAI1, Yanyan GUO1, Chunping LIN2, Xiaomei HOU1,*(), Chanyuan JIN1,*()   

  1. 1. Second Clinical Division, Peking University School and Hospital of Stomatology & National Center of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Research Center of Oral Biomaterials and Digi-tal Medical Devices & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
    2. Department of Stomatology, Shengli Clinical Medical College of Fujian Medical University, Fujian Provincial Hospital, Fuzhou University Affiliated Provincial Hospital, Fuzhou 350001, China
  • Received:2024-09-12 Online:2025-02-18 Published:2025-01-25
  • Contact: Xiaomei HOU, Chanyuan JIN E-mail:houxiaomei1108@163.com;jinchanyuanjcy@bjmu.edu.cn
  • Supported by:
    the Young Elite Scientists Sponsorship Program by China Association for Science and Technology(YESS20220554);Beijing Young Elite Scientists Sponsorship Program by Beijing Association for Science and Technology(BYESS2024297)

RICH HTML

  

Abstract:

Objective: To initially investigate the function of neuronal pentraxin 1 (NPTX1) gene on osteogenic differentiation of human bone marrow mesenchymal stem cells (hBMSCs). Methods: hBMSCs were induced to undergo osteogenic differentiation, and then RNA was collected at different time points, namely 0, 3, 7, 10 and 14 d. The mRNA expression levels of key genes related with osteogenic differentiation, including runt-related transcription factor 2 (RUNX2), alkaline phosphatase (ALP), osteocalcin (OCN), and NPTX1, were detected on the basis of quantitative real-time polymerase chain reaction (qPCR) technology. In order to establish a stable NPTX1-knockdown hBMSCs cell line, NPTX1 shRNA lentivirus was constructed and used to infect hBMSCs. ALP staining, alizarin red (AR) staining, and qPCR were employed to assess the impact of NPTX1-knockdown on the osteogenic differentiation ability of hBMSCs. Results: The results showed that during the osteogenic differentiation of hBMSCs in vitro, the mRNA expression levels of osteogenic genes RUNX2, ALP and OCN significantly increased compared with 0 d, while NPTX1 expression decreased markedly (P < 0.01) as the osteogenic induction period exten-ded. At 72 h post-infection with lentivirus, the result of qPCR indicated that the knockdown efficiency of NPTX1 was over 60%. After knocking down NPTX1 in hBMSCs, RNA was extracted from both the NPTX1-knockdown group (sh NPTX1 group) and the control group (shNC group) cultured in regular proliferation medium. The results of qPCR showed that the expression levels of osteogenic-related genes RUNX2 and osterix (OSX) were significantly higher in the sh NPTX1 group compared with the shNC group (P < 0.01). ALP staining revealed a significantly deeper coloration in the sh NPTX1 group than in the shNC group at the end of 7 d of osteogenic induction. AR staining demonstrated a marked increase in mineralized nodules in the sh NPTX1 group compared with the shNC group at the end of 14 d of osteogenic induction. Conclusion: NPTX1 exerts a modulatory role in the osteogenic differentiation of hBMSCs, and its knockdown has been found to enhance the osteogenic differentiation of hBMSCs. This finding implies that NPTX1 could potentially serve as a therapeutic target for the treatment of osteogenic abnormalities, including osteoporosis.

Key words: Bone marrow mesenchymal stem cells, NPTX1 gene, Osteogenic differentiation

CLC Number: 

  • R34

Table 1

Primer sequences used for qPCR"

Gene nameForward primer sequences (5' to 3')Reverse primer sequences (5' to 3')
NPTX1CAGCGAGCTCGAGAAAGGTCATCCGCAGTGGGAATGTGAGC
GAPDHCGGACCAATACGACCAAATCCGAGCCACATCGCTCAGACACC
RUNX2TCTTAGAACAAATTCTGCCCTTTTGCTTTGGTCTTGAAATCACA
ALPGACCTCCTCGGAAGACACTCTGAAGGGCTTCTTGTCTGTG
OCNAGCAAAGGTGCAGCCTTTGTGCGCCTGGGTCTCTTCACT
OSXCCTCCTCAGCTCACCTTCTCGTTGGGAGCCCAAATAGAAA

Table 2

shRNA sequences of lentiviruses"

shRNA nameshRNA sequences (5' to 3')
shNCTTCTCCGAACGTGTCACGT
shNPTX1GGATCTGCTGCAGAGCAAGAT

Figure 1

Expression level of NPTX1 and osteogenesis-related genes after osteogenic induction in hBMSCs A, the mRNA expression level of NPTX1 after 0, 3, 7, 14 d of osteoge-nic induction in hBMSCs; B, the mRNA expression level of RUNX2 after 0, 3, 7, 14 d of osteogenic induction in hBMSCs; C, the mRNA expression level of ALP after 0, 3, 7, 14 d of osteogenic induction in hBMSCs; D, the mRNA expression level of OCN after 0, 3, 7, 14 d of osteogenic induction in hBMSCs. ** P < 0.01, vs. 0 d. hBMSCs, human bone marrow mesenchymal stem cells. The other abbreviation as in Table 1."

Figure 2

Transfection efficiency of NPTX1 was examined by qPCR ** P < 0.01, vs. shNC group. NPTX1, neuronal pentraxin 1; NC, negative control; qPCR, quantitative real-time polymerase chain reaction."

Figure 3

Results after osteogenic induction in NPTX1-knockdown hBMSCs A, mRNA expression level of RUNX2 under PM conditions in NPTX1-knockdown hBMSCs and shNC hBMSCs; B, mRNA expression level of OSX under PM conditions in NPTX1-knockdown hBMSCs and shNC hBMSCs; C, ALP staining results after osteogenic induction in NPTX1-knockdown hBMSCs. ** P < 0.01, vs. shNC group. PM, proliferation medium; OM, osteogenic medium; hBMSCs, human bone marrow mesenchymal stem cells; NC, negative control. The other abbreviation as in Table 1."

Figure 4

Results of AR staining after osteogenic induction in NPTX1-knockdown hBMSCs A, results of AR staining after osteogenic induction in NPTX1-knockdown hBMSCs; B, quantitative results of AR staining after osteogenic induction in NPTX1-knockdown hBMSCs. ** P < 0.01, vs. shNC group. PM, proliferation medium; OM, adipogenic medium; AR, alizarin red; NPTX1, neuronal pentraxin 1; NC, negative control."

1 Chu DT , Phuong TNT , Tien NLB , et al. An update on the progress of isolation, culture, storage, and clinical application of human bone marrow mesenchymal stem/stromal cells[J]. Int J Mol Sci, 2020, 21 (3): 708.
doi: 10.3390/ijms21030708
2 Pharoun J , Berro J , Sobh J , et al. Mesenchymal stem cells biolo-gical and biotechnological advances: Implications for clinical applications[J]. Eur J Pharmacol, 2024, 977, 176719.
doi: 10.1016/j.ejphar.2024.176719
3 Chen Y , Huang Y , Li J , et al. Enhancing osteoporosis treatment with engineered mesenchymal stem cell-derived extracellular vesicles: Mechanisms and advances[J]. Cell Death Dis, 2024, 15 (2): 119.
doi: 10.1038/s41419-024-06508-w
4 Zhang J , Hu W , Zou Z , et al. The role of lipid metabolism in osteoporosis: Clinical implication and cellular mechanism[J]. Genes Dis, 2023, 11 (4): 101122.
5 Zhang JY , Li LC . Genetic expression and functional characterization of the RUNX2 gene in human adult bone marrow mesenchymal stem cells[J]. Genet Mol Res, 2015, 14 (4): 18210- 18217.
doi: 10.4238/2015.December.23.8
6 Li Y , Zhang S , Liu J , et al. The pentraxin family in autoimmune disease[J]. Clin Chim Acta, 2023, 551, 117592.
doi: 10.1016/j.cca.2023.117592
7 Coutelier M , Jacoupy M , Janer A , et al. NPTX1 mutations trigger endoplasmic reticulum stress and cause autosomal dominant cerebellar ataxia[J]. Brain, 2022, 145 (4): 1519- 1534.
doi: 10.1093/brain/awab407
8 Zhou C , Qin Y , Xie Z , et al. NPTX1 is a novel epigenetic regulation gene and associated with prognosis in lung cancer[J]. Biochem Biophys Res Commun, 2015, 458 (2): 381- 386.
doi: 10.1016/j.bbrc.2015.01.124
9 Yan H , Zheng C , Li Z , et al. NPTX1 promotes metastasis via integrin/FAK signaling in gastric cancer[J]. Cancer Manag Res, 2019, 11, 3237- 3251.
doi: 10.2147/CMAR.S196509
10 Peng X , Pan K , Zhao W , et al. NPTX1 inhibits colon cancer cell proliferation through down-regulating cyclin A2 and CDK2 expression[J]. Cell Biol Int, 2018, 42 (5): 589- 597.
doi: 10.1002/cbin.10935
11 Adejuyigbe B , Kallini J , Chiou D , et al. Osteoporosis: Molecular pathology, diagnostics, and therapeutics[J]. Int J Mol Sci, 2023, 24 (19): 14583.
doi: 10.3390/ijms241914583
12 Qaseem A , Hicks LA , Etxeandia-Ikobaltzeta I , et al. Pharmacologic treatment of primary osteoporosis or low bone mass to prevent fractures in adults: A living clinical guideline from the american college of physicians[J]. Ann Intern Med, 2023, 176 (2): 224- 238.
doi: 10.7326/M22-1034
13 Wang C , Liu Y , Hu X , et al. Titanium dioxide nanotubes increase purinergic receptor P2Y6 expression and activate its downstream PKCα-ERK1/2 pathway in bone marrow mesenchymal stem cells under osteogenic induction[J]. Acta Biomater, 2023, 157, 670- 682.
doi: 10.1016/j.actbio.2022.11.045
14 Meng M , Xia Q , Li Y , et al. Enamel matrix derivative expedites osteogenic differentiation of BMSCs via Wnt/β-catenin pathway in high glucose microenvironment[J]. J Bone Miner Metab, 2022, 40 (3): 448- 459.
doi: 10.1007/s00774-022-01318-6
15 Chen SC , Jiang T , Liu QY , et al. Hsa_circ_0001485 promoted osteogenic differentiation by targeting BMPR2 to activate the TGFβ-BMP pathway[J]. Stem Cell Res Ther, 2022, 13 (1): 453.
doi: 10.1186/s13287-022-03150-1
16 Wang YJ , Zhang HQ , Han HL , et al. Taxifolin enhances osteogenic differentiation of human bone marrow mesenchymal stem cells partially via NF-κB pathway[J]. Biochem Biophys Res Commun, 2017, 490 (1): 36- 43.
doi: 10.1016/j.bbrc.2017.06.002
17 Zhang J , Zhu L , Zhou J , et al. Ubiquitination of ASCL1 mediates CD47 transcriptional activation of the AKT signaling pathway, and glycolysis promotes osteogenic differentiation of hBMSCs[J]. In Vitro Cell Dev Biol Anim, 2023, 59 (8): 636- 648.
doi: 10.1007/s11626-023-00811-0
18 Wu J , Cai P , Lu Z , et al. Identification of potential specific biomarkers and key signaling pathways between osteogenic and adipogenic differentiation of hBMSCs for osteoporosis therapy[J]. J Orthop Surg Res, 2020, 15 (1): 437.
doi: 10.1186/s13018-020-01965-3
19 Greggi C , Cariati I , Onorato F , et al. PTX3 Effects on osteogenic differentiation in osteoporosis: An in vitro study[J]. Int J Mol Sci, 2021, 22 (11): 5944.
doi: 10.3390/ijms22115944
20 Tarantino U , Greggi C , Cariati I , et al. The role of PTX3 in mineralization processes and aging-related bone diseases[J]. Front Immunol, 2021, 11, 622772.
doi: 10.3389/fimmu.2020.622772
21 鲁佳君, 孙岩, 张煊, 等. 正五聚蛋白3在骨质疏松和骨折愈合中的研究进展[J]. 中国骨伤, 2023, 36 (4): 393- 398.
[1] Liting ZENG, Kaiyuan CHENG, Zhongning LIU, Jian LI, Jingwen YANG, Ting JIANG. miR-488-5p promotes osteogenic and neurogenic differentiation of rat bone marrow mesenchymal stem cells and enhances neuralized bone regeneration [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 10-21.
[2] Chunhui SHENG, Xiao ZHANG, Longwei LV, Yongsheng ZHOU. Exosome derived from human adipose-derived mesenchymal stem cells prevented bone loss induced by estrogen deficiency [J]. Journal of Peking University (Health Sciences), 2025, 57(2): 217-226.
[3] Yibo HU, Weijia LYU, Wei XIA, Yihong LIU. Hydrodynamic finite element analysis of biological scaffolds with different pore sizes for cell growth and osteogenic differentiation [J]. Journal of Peking University (Health Sciences), 2025, 57(1): 97-105.
[4] SHUAI Ting,LIU Juan,GUO Yan-yan,JIN Chan-yuan. Knockdown of long non-coding RNA MIR4697 host gene inhibits adipogenic differentiation in bone marrow mesenchymal stem cells [J]. Journal of Peking University (Health Sciences), 2022, 54(2): 320-326.
[5] Jing XIE,Yu-ming ZHAO,Nan-quan RAO,Xiao-tong WANG,Teng-jiao-zi FANG,Xiao-xia LI,Yue ZHAI,Jing-zhi LI,Li-hong GE,Yuan-yuan WANG. Comparative study of differentiation potential of mesenchymal stem cells derived from orofacial system into vascular endothelial cells [J]. Journal of Peking University(Health Sciences), 2019, 51(5): 900-906.
[6] Xia LIU,Ying ni LI,Xiao li SUN,Qing lin PENG,Xin LU,Guo chun WANG. Effects of integrin metalloproteinases on osteogenic differentiation [J]. Journal of Peking University(Health Sciences), 2018, 50(6): 962-967.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!