Journal of Peking University (Health Sciences) ›› 2025, Vol. 57 ›› Issue (4): 727-734. doi: 10.19723/j.issn.1671-167X.2025.04.016

Previous Articles     Next Articles

Protective effect of knock-down the expression of Blimp1 gene on early liver injury in CCl4-induced mouse model of liver fibrosis

Qiushi QIN1, Rui LI2,3, Yanxi ZHOU2,3, Yue ZHANG2,3, Ming HAN2,3, Liuluan ZHU1,2,3,*()   

  1. 1. Peking University Ditan Teaching Hospital, Beijing 100015, China
    2. Beijing Key Laboratory of Emerging Infectious Diseases, Institute of Infectious Diseases, Beijing Ditan Hospital, Capital Medical University, Beijing 100015, China
    3. Beijing Institute of Infectious Diseases, Beijing 100015, China
  • Received:2022-09-16 Online:2025-08-18 Published:2025-08-02
  • Contact: Liuluan ZHU
  • Supported by:
    the National Natural Science Foundation of China(81871586); the National Natural Science Foundation of China(81671940)

RICH HTML

  

Abstract:

Objective: To explore the protective effect of knock-down the expression of B lymphocyte induced maturation protein 1 (Blimp1) gene on early liver injury in carbon tetrachloride (CCl4)-induced mouse model of liver fibrosis. Methods: C57BL/6 mice were intraderitoneal injected with 5% CCl4 olive oil solution to create mouse model of hepatic fibrosis. The expression of Blimp1 gene in the mice was reduced by intraderitoneal injection of short hairpin RNA (shRNA) adeno-associated virus (AAV). The mice were randomly divided into 3 groups: blank test group (n=10), CCl4+AAV-shRNA-NC group (n=10) and CCl4+AAV-shRNA-Blimp1 group (n=10). After 27 days of preparation of the CCl4 mouse model, animal materials were carried out. Western blot and real-time PCR were used to detect the levels of Blimp1, α-smooth muscle actin (α-SMA), collagen type Ⅰ alpha 1 (COL1A1), collagen type Ⅲ alpha 1 (COL3A1), and their mRNA expression levels of liver tissue in each group. The serum of each group was separated to measure aspartate transaminase (AST) and alanine transaminase (ALT) by automatic biochemical analyzer. The pathological changes of liver tissue and the degree of liver fibrosis in the mice were detected by pathological staining including hematoxylin-eosin staining, Masson, and Sirius red. Results: The expression levels of Blimp1 protein in the liver of CCl4+AAV-shRNA-NC group (2.036±0.244, t=3.690, P=0.002) were significantly increased than that of the blank test group. In the CCl4+AAV-shRNA-Blimp1 group, the expression of Blimp1 protein decreased to the basal level (0.783±0.249, t=6.223, P=0.003). Compared with the serum levels of ALT [(1 957.8±633.6) U/L] and AST [(1 808.8±260.1) U/L] in the CCl4+AAV-shRNA-NC group, the serum levels of ALT [(894.0±360.1) U/L, t=3.998, P=0.003] and AST [(820.0±100.6) U/L, t=6.141, P=0.004] in the CCl4+AAV-shRNA-Blimp1 group were significantly decreased. The pathological results of the CCl4+AAV-shRNA-Blimp1 group showed that compared with the CCl4+AAV-shRNA-NC group, the infiltration of inflammatory cells in the liver tissue was reduced and the degree of fibrosis was alleviated. The level of α-SMA (0.676±0.064, t=7.930, P=0.001), COL1A1 (1.426±0.143, t=6.364, P=0.003) and COL3A1 (1.124±0.198, t=3.440, P=0.026) of liver in the CCl4+AAV-shRNA-Blimp1 group were significantly decreased than that of CCl4+AAV-shRNA-NC group, and the mRNA expression levels were altered as well as their protein levels. Conclusion: Blimp1 plays an important role in CCl4-induced liver fibrosis in mice, and knock-down the expression of Blimp1 gene is beneficial to protect early liver injury in mice.

Key words: Liver fibrosis, Liver injury, Animal models, B lymphocyte induced maturation protein 1

CLC Number: 

  • R575.2

Table 1

The sequences of shRNA-Blimp1 and shRNA-NC"

shRNA Oligonucleotides (5′-3′)
shRNA-NC CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTT
shRNA-Blimp1-1 AAAAGGTGCAGCCTTTATGAGTCCTCGAGGACTCATAAAGGCTGCACC
shRNA-Blimp1-2 AAAACTCTCGACAGCAAATGGTTCTCGAGAACCATTTGCTGTCGAGAG
shRNA-Blimp1-3 AAAAGCAGGATTACCCAAGAATACTCGAGTATTCTTGGGTAATCCTGC

Figure 1

Expression levels of Blimp1 in RAW264.7 cells(A, B) and the liver of mice(C, D) The interference efficiency of three shRNA-Blimp1 in RAW264.7 cells and the expression levels of Blimp1 in the liver of blank test, CCl4+AAV-shRNA-NC and CCl4+AAV-shRNA-Blimp1 group mice (n=10). *P < 0.05, **P < 0.01, ***P < 0.001. shRNA, short hairpin RNA; Blimp1, B lymphocyte induced maturation protein 1; CCl4, carbon tetrachloride; AAV, adeno-associated virus; NC, non-specific control; CCl4-sh-NC, CCl4+AAV-shRNA-NC group; CCl4-sh-Blimp1, CCl4+AAV-shRNA-Blimp1 group."

Figure 2

The dynamic changes of body weight in each group mice during modeling The dynamic changes of body weight in the blank test, CCl4+AAV-shRNA-NC and CCl4+AAV-shRNA-Blimp1 group mice (n=10). Abbreviations as in Figure 1."

Figure 3

The ALT and AST levels of serum in each group mice The ALT(A) and AST(B) levels of serum in the blank test, CCl4+AAV-shRNA-NC and CCl4+AAV-shRNA-Blimp1 group mice (n=10). **P < 0.01, ***P < 0.001, ****P < 0.000 1. AST, aspartate transaminase; ALT, alanine transaminase; Other abbreviations as in Figure 1."

Figure 4

Pathological staining of liver tissue in each group Pathological staining of liver tissue in the blank test, CCl4+AAV-shRNA-NC and CCl4+AAV-shRNA-Blimp1 group mice (n=10). The yellow arrows represent inflammatory infiltration, the black arrows represent collagen deposition, and the blue arrows represent liver fibrosis. HE, hematoxylin-eosin staining; Other abbreviations as in Figure 1."

Figure 5

The α-SMA, COL1A1 and COL3A1 levels in liver of mice in each group A and B, the α-SMA, COL1A1 and COL3A1 levels in liver of mice in each group (n=10); C, the mRNA levels of Acta2, Col1a1 and Col3a1 in liver of mice in each group (n=10). * P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.000 1. The Acta2, Col1a1 and Col3a1 is the coding gene of α-SMA, COL1A1 and COL3A1, respectively. Abbreviations as in Figure 1."

1
Marcellin P , Kutala BK . Liver diseases: A major, neglected global public health problem requiring urgent actions and large-scale screening[J]. Liver Int, 2018, 38 (Suppl 1): 2- 6.
2
Ramachandran P , Dobie R , Wilson-Kanamori JR , et al. Resolving the fibrotic niche of human liver cirrhosis at single-cell level[J]. Nature, 2019, 575 (7783): 512- 518.
3
Friedman SL , Pinzani M . Hepatic fibrosis 2022:Unmet needs and a blueprint for the future[J]. Hepatology, 2022, 75 (2): 473- 488.
4
Rockey DC , Bell PD , Hill JA . Fibrosis: A common pathway to organ injury and failure[J]. N Engl J Med, 2015, 372 (12): 1138- 1149.
5
Shapiro-Shelef M , Lin KI , McHeyzer-Williams LJ , et al. Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells[J]. Immunity, 2003, 19 (4): 607- 620.
6
Minnich M , Tagoh H , Bönelt P , et al. Multifunctional role of the transcription factor Blimp-1 in coordinating plasma cell differentiation[J]. Nat Immunol, 2016, 17 (3): 331- 343.
7
Bankoti R , Ogawa C , Nguyen T , et al. Differential regulation of effector and regulatory T cell function by Blimp1[J]. Sci Rep, 2017, 7 (1): 12078.
8
Shin H , Blackburn SD , Intlekofer AM , et al. A role for the transcriptional repressor Blimp-1 in CD8(+) T cell exhaustion during chronic viral infection[J]. Immunity, 2009, 31 (2): 309- 320.
9
Savitsky D , Cimmino L , Kuo T , et al. Multiple roles for Blimp-1 in B and T lymphocytes[J]. Adv Exp Med Biol, 2007, 596, 9- 30.
10
Kim SJ , Zou YR , Goldstein J , et al. Tolerogenic function of Blimp-1 in dendritic cells[J]. J Exp Med, 2011, 208 (11): 2193- 2199.
11
Gateva V , Sandling JK , Hom G , et al. A large-scale replication study identifies TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10 as risk loci for systemic lupus erythematosus[J]. Nat Genet, 2009, 41 (11): 1228- 1233.
12
Ellinghaus D , Zhang H , Zeissig S , et al. Association between variants of PRDM1 and NDP52 and Crohn ' s disease, based on exome sequencing and functional studies[J]. Gastroenterology, 2013, 145 (2): 339- 347.
13
Boi M , Zucca E , Inghirami G , et al. PRDM1/BLIMP1:A tumor suppressor gene in B and T cell lymphomas[J]. Leuk Lymphoma, 2015, 56 (5): 1223- 1228.
14
Li N , Fan X , Wang X , et al. PRDM1 levels are associated with clinical diseases in chronic HBV infection and survival of patients with HBV-related hepatocellular carcinoma[J]. Int Immunopharmacol, 2019, 73, 156- 162.
15
Scholten D , Trebicka J , Liedtke C , et al. The carbon tetrachloride model in mice[J]. Lab Anim, 2015, 49 (Suppl 1): 4- 11.
16
Bárcena C , Aran G , Perea L , et al. CD5L is a pleiotropic player in liver fibrosis controlling damage, fibrosis and immune cell content[J]. EBioMedicine, 2019, 43, 513- 524.
17
Pellicano AJ , Spahn K , Zhou P , et al. Collagen characterization in a model of nonalcoholic steatohepatitis with fibrosis: A call for development of targeted therapeutics[J]. Molecules, 2021, 26 (11): 3316.
18
Fan W , Liu T , Chen W , et al. ECM1 prevents activation of transforming growth factor β, hepatic stellate cells, and fibrogenesis in mice[J]. Gastroenterology, 2019, 157 (5): 1352- 1367.
19
Friedman SL . Hepatic stellate cells: Protean, multifunctional, and enigmatic cells of the liver[J]. Physiol Rev, 2008, 88 (1): 125- 172.
20
Xu XY , Ding HG , Li WG , et al. Chinese guidelines on management of hepatic encephalopathy in cirrhosis[J]. World J Gastroenterol, 2019, 25 (36): 5403- 5422.
21
Cao Y , Mai W , Li R , et al. Macrophages evoke autophagy of hepatic stellate cells to promote liver fibrosis in NAFLD mice via the PGE2/EP4 pathway[J]. Cell Mol Life Sci, 2022, 79 (6): 303.
22
Kiziltas S . Toll-like receptors in pathophysiology of liver diseases[J]. World J Hepatol, 2016, 8 (32): 1354- 1369.
23
Seki E , De Minicis S , Osterreicher CH , et al. TLR4 enhances TGF-beta signaling and hepatic fibrosis[J]. Nat Med, 2007, 13 (11): 1324- 1332.
24
Genestier L , Taillardet M , Mondiere P , et al. TLR agonists selectively promote terminal plasma cell differentiation of B cell subsets specialized in thymus-independent responses[J]. J Immunol, 2007, 178 (12): 7779- 7786.
25
Ko YA , Chan YH , Liu CH , et al. Blimp-1-mediated pathway promotes type Ⅰ IFN production in plasmacytoid dendritic cells by targeting to interleukin-1 receptor-associated kinase M[J]. Front Immunol, 2018, 9, 1828.
26
Dewidar B , Meyer C , Dooley S , et al. TGF-β in hepatic stellate cell activation and liver fibrogenesis-updated 2019[J]. Cells, 2019, 8 (11): 1419.
27
Flores-Contreras L , Sandoval-Rodríguez AS , Mena-Enriquez MG , et al. Treatment with pirfenidone for two years decreases fibrosis, cytokine levels and enhances CB2 gene expression in patients with chronic hepatitis C[J]. BMC Gastroenterol, 2014, 14, 131.
[1] Lingyu MENG, Yonghui HUANG, Xiu'e YAN, Yingchun WANG. Establishment of rabbit model of benign circumferential esophageal stricture [J]. Journal of Peking University (Health Sciences), 2026, 58(2): 380-387.
[2] Yadong GAO, An ZHU, Ludi LI, Yingzi LI, Qi WANG. Effect of the combination of alkaloids from Euodiae Fructus and berberine in Zuojin Pill on cytotoxicity in HepG2 cells [J]. Journal of Peking University (Health Sciences), 2025, 57(5): 926-933.
[3] Ling-wei MENG,Xue LI,Sheng-han GAO,Yue LI,Rui-tao CAO,Yi ZHANG,Shao-xia PAN. Comparison of three methods for establishing rat peri-implantitis model [J]. Journal of Peking University (Health Sciences), 2023, 55(1): 22-29.
[4] WANG Gui-hong,ZUO Ting,LI Ran,ZUO Zheng-cai. Effect of rebamipide on the acute gouty arthritis in rats induced by monosodium urate crystals [J]. Journal of Peking University (Health Sciences), 2021, 53(4): 716-720.
[5] WU Shan-Shan, ZHANG Yue-Lun, WANG Wei-Wei, CHEN Ru, SUN Feng, ZHAN Si-Yan- . Liver injury associated with treatment of multidrug-resistant tuberculosis: a syste-matic review and metaanalysis [J]. Journal of Peking University(Health Sciences), 2014, 46(3): 417-423.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!