Journal of Peking University(Health Sciences) ›› 2019, Vol. 51 ›› Issue (6): 1108-1114. doi: 10.19723/j.issn.1671-167X.2019.06.023

Previous Articles     Next Articles

Effects of mineral trioxide aggregate and ethanolic extracts of Shandong propolis on the biological properties of human dental pulp fibroblasts

Bing-qing SHI,Xiao-jing YUAN,Yu-ming ZHAO()   

  1. Department of Pediatric Dentistry, Peking University School and Hospital of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
  • Received:2017-12-26 Online:2019-12-18 Published:2019-12-19
  • Contact: Yu-ming ZHAO E-mail:yumingzhao70@sina.com
  • Supported by:
    Supported by the Capital Featured Clinical Application Research Project of Beijing Municipal Science & Technology Commission(Zl51100004015093)

RICH HTML

  

Abstract:

Objective: To evaluate the effect of mineral trioxide aggregate (MTA) and propolis from Shangdong province on the cell viability, mineralization and migration and anti-inflammatory ability of dental pulp fibroblasts.Methods: The human dental pulp fibroblasts were cultured and subjected to 10 mg/L of propolis and 1 ∶8 dilution of MTA extraction. The cell viability was evaluated with cell counting kit-8 (CCK-8) after 1, 5, 7 and 9 days. The cells in the upper inserts and the test culture media on the bottoms of 24-well plates interacted for 15 hours. Then the numbers of cells migrated through the per-meable membranes were compared. The cells seeded in the 24-well plates were incubated in osteogenic medium with different materials for 21 days and stained with alizarin red S, then photographed. To evaluate the deposition of calcified matrix, the wells were destained with 100 mmol/L cetylpyridinium chloride. Finally, the cells were exposed to 1 mg/L lipopolysaccharide (LPS) to induce an inflammatory response, in the presence of propolis, MTA extraction. The cells were collected after 3 h, and the expressions of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6) were determined using real-time polymerase chain reaction (real-time PCR). Statistical analysis was performed by one-way ANOVA and nonparametric tests (P<0.05).Results: The cell viability of propolis group was significantly lower than those of MTA and control groups on days 5, 7 and 9, while MTA significantly increased the numbers of the viable cells on days 7 and 9. The migration cells of propolis group (26.67±2.52) were fewer than control group (61.33±4.93), and the cells of MTA group (80.00±2.65) were statistically more than those of the other two groups. The propolis group significantly induced more calcified matrix deposition than MTA group after 21 days of culture. Propolis significantly suppressed the expressions of IL-1β and IL-6 after LPS exposure compared with MTA and control groups.Conclusion: The propolis from Shandong compared with MTA showed a certain degree of cytotoxicity, and had no significant effect on cell migration. On the other hand, propolis exhibited significant anti-inflammatory and mineralization promotion effect, suggesting that the active ingredients of propolis could be introduced as a supplement of pulp capping materials, or used as an irrigant or intracanal medicament due to its excellent anti-inflammatory effect. Propolis may have potential in vital pulp treatment of young permanent tooth suffering pulp inflammation.

Key words: Propolis, Dental pulp, Fibroblasts, Anti-inflammatory effect, Mineral trioxide aggregate

CLC Number: 

  • R788.2

Figure 1

The first passage human dental pulp cells (×4)"

Table 1

Primer sequences of three inflammatory cytokines"

Gene Primer sequences
TNF-α F: CGAGTGACAAGCCTGTAGCC R: TGAAGAGGACCTGGGAGTAGAT
IL-1β F: AGCTCGCCAGTGAAATGATG R: GCCCTTGCTGTAGTGGTGGT
IL-6 F: GAAAGCAGCAAAGAGGCACT R: TTTCACCAGGCAAGTCTCCT

Figure 2

The effect of various concentrations of Shandong propolis (A) and MTA extraction (B) on cell viability in primary culture of dental pulp cells by CCK-8 after 1 or 3 days; the effect of different materials on cell viability in primary culture of dental pulp cells by CCK-8 after 1, 5, 7, 9 days (C) Control, Dulbecco’s modified eagle medium (DMEM) group; sd, Shandong propolis group; MTA, mineral trioxide aggregate (MTA) extraction group. *P<0.05, ** P<0.01, compared with control; #P<0.05, ## P<0.01, compared with MTA."

Figure 2

The effect of various concentrations of Shandong propolis (A) and MTA extraction (B) on cell viability in primary culture of dental pulp cells by CCK-8 after 1 or 3 days; the effect of different materials on cell viability in primary culture of dental pulp cells by CCK-8 after 1, 5, 7, 9 days (C) Control, Dulbecco’s modified eagle medium (DMEM) group; sd, Shandong propolis group; MTA, mineral trioxide aggregate (MTA) extraction group. *P<0.05, ** P<0.01, compared with control; #P<0.05, ## P<0.01, compared with MTA."

Figure 3

The number of cells migrate through permeable membranes in different groups after seeded for 15 hours Abbreviation as in Figure 2. ** P<0.01, compared with control, ## P<0.01, compared with MTA."

Figure 4

Alizarin red staining of cells cultured with different materials for 21 days A, staining of the different groups; B, quantification of alizarin red stain-ing (1 :10 dilution). ** P<0.01, compared with control, ## P<0.01, compared with MTA. DMEM, ordinary DMEM medium group; om, osteogenic medium group; sd, Shandong propolis + osteogenic medium group; MTA, MTA extraction + osteogenic medium group."

Figure 5

The expression of TNF-α, IL-1β and IL-6 in different groups after LPS stimulation for 3 hours Control, LPS group; sd, Shandong propolis + LPS group; MTA, MTA extraction + LPS group. *P<0.05, compared with control, # P<0.05, compared with MTA."

[1] Al-Shaher A, Wallace J, Agarwal S , et al. Effect of propolis on human fibroblasts from the pulp and periodontal ligament[J]. J Endod, 2004,30(5):359-361.
[2] Al-Haj Ali SN . In vitro toxicity of propolis in comparison with other primary teeth pulpotomy agents on human fibroblasts[J]. J Investig Clin Dent, 2016,7(3):308-313.
[3] Jacob A, Parolia A, Pau A , et al. The effects of Malaysian propolis and Brazilian red propolis on connective tissue fibroblasts in the wound healing process[J]. BMC Complement Altern Med, 2015,15(1):294.
[4] Moradi S, Saghravanian N, Moushekhian S , et al. Immunohistochemical evaluation of fibronectin and tenascin following direct pulp capping with mineral trioxide aggregate, platelet-rich plasma and propolis in dogs’ teeth[J]. Iran Endod J, 2015,10(3):188-192.
[5] Parolia A, Kundabala M, Rao N , et al. A comparative histological analysis of human pulp following direct pulp capping with Propolis, mineral trioxide aggregate and Dycal[J]. Aust Dent J, 2010,55(1):59-64.
[6] ISO10993-12-2007医疗器械生物学评价——第12部分:样品制备与参照样品[S].
[7] Rodrigues EM, Cornélio ALG, Mestieri LB , et al. Human dental pulp cells response to MTA and MTA Plus: Cytotoxicity and gene expression analysis[J]. International Endodontic Journal, 2016,50(8):780-789.
[8] Zare Jahromi M, Ranjbarian P, Shiravi S . Cytotoxicity evaluation of Iranian propolis and calcium hydroxide on dental pulp fibroblasts[J]. J Dent Res Dent Clin Dent Prospects, 2014,8(3):130-133.
[9] 刘颖婷, 张玉皓 . 水溶蜂胶对人牙髓成纤维细胞的毒性作用研究[J]. 中国现代医学杂志, 2015,25(30):18-22.
[10] Chang H, Wang Y, Yin X , et al. Ethanol extract of propolis and its constituent caffeic acid phenethyl ester inhibit breast cancer cells proliferation in inflammatory microenvironment by inhibiting TLR4 signal pathway and inducing apoptosis and autophagy[J]. BMC Complement Altern Med, 2017,17(1):471.
[11] Margunato S, Tasli PN, Aydin S , et al. In vitro evaluation of ProRoot MTA, Biodentine, and MM-MTA on human alveolar bone marrow stem cells in terms of biocompatibility and mineralization[J]. J Endod, 2015,41(10):1646-1652.
[12] Kabala-Dzik A, Rzepecka-Stojko A, Kubina R , et al. Migration rate inhibition of breast cancer cells treated by caffeic acid and caffeic acid phenethyl ester: An in vitro comparison study[J]. Nutrients, 2017,9(10):1144.
[13] Bueno-Silva B, Franchin M, Alves C , et al. Main pathways of action of Brazilian red propolis on the modulation of neutrophils migration in the inflammatory process[J]. Phytomedicine, 2016,23(13):1583-1590.
[14] Ahangari Z, Naseri M, Jalili M , et al. Effect of propolis on dentin regeneration and the potential role of dental pulp stem cell in Guinea pigs[J]. Cell J, 2012,13(4):223-228.
[15] Lima Cavendish R, de Souza Santos J, Belo Neto R , et al. Anti-nociceptive and anti-inflammatory effects of Brazilian red propolis extract and formononetin in rodents[J]. J Ethnopharmacol, 2015,173:127-133.
[16] das Neves MV, da Silva TM, Lima Ede O , et al. Isoflavone for-mononetin from red propolis acts as a fungicide against Candida sp.[J]. Braz J Microbiol, 2016,47(1):159-166.
[17] Gemiarto AT, Ninyio NN, Lee SW , et al. Isoprenyl caffeate, a major compound in manuka propolis, is a quorum-sensing inhibitor in Chromobacterium violaceum[J]. Antonie Van Leeuwenhoek, 2015,108(2):491-504.
[18] Saha S, Nair R and Asrani H. Comparative evaluation of propolis, metronidazole with chlorhexidine, calcium hydroxide and curcuma longa extract as intracanal medicament against E. faecalis: An in vitro study [J]. J Clin Diagn Res, 2015, 9(11): ZC19-21.
[19] Bhandari S, Ashwini TS, Patil CR . An in vitro evaluation of antimicrobial efficacy of 2% chlorhexidine gel,propolis and calcium hydroxide against Enterococcus faecalis in human root dentin [J]. J Clin Diagn Res, 2014, 8(11): ZC60-63.
[20] Neiva K, Catalfamo D, Holliday S , et al. Propolis decreases lipopolysaccharide-induced inflammatory mediators in pulp cells and osteoclasts[J]. Dent Traumatol, 2014,30(5):362-367.
[21] Kusum B, Rakesh K, Richa K . Clinical and radiographical evaluation of mineral trioxide aggregate, biodentine and propolis as pulpotomy medicaments in primary teeth[J]. Restor Dent Endod, 2015,40(4):276-285.
[22] Altunsoy M, Tanrıver M, Türkan U , et al. In vitro evaluation of microleakage and microhardness of ethanolic extracts of propolis in different proportions added to glass ionomer cement[J]. J Clin Pediatr Dent, 2016,40(2):136-140.
[23] Prabhakar AR, Balehosur DV, Basappa N. Comparative evaluation of shear bond strength and fluoride release of conventional glass ionomer with 1% ethanolic extract of propolis incorporated glass ionomer cement: In vitro study [J]. J Clin Diagn Res, 2016, 10(5): ZC88-91.
[24] Grenho L, Barros J, Ferreira C , et al. In vitro antimicrobial acti-vity and biocompatibility of propolis containing nanohydroxyapatite[J]. Biomed Mater, 2015,10(2):025004.
[1] Xiaojuan MA, Hao WANG, Xueqin MA, Ying SONG, Jiahui YU, Yan SUN, Yanfang LI, Lixiang XUE, Xianlong LI, Jianling YANG, Yan WANG. A new method for extracting adult mouse cardiac fibroblasts more efficiently and stably [J]. Journal of Peking University (Health Sciences), 2026, 58(3): 658-665.
[2] Ruofan GAO, Tianyu MA, Runkai WANG, Yuchen YIN, Ruidi LI, Dandan WANG, Bin XIA. Anti-inflammatory effects of cell membrane vesicle-mediated delivery of small interfering RNA targeting tumor necrosis factor-α on dental pulp stem cells [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 22-29.
[3] Miao ZHENG, Xinrong MA, Hao CHEN, Hengxin ZHAO, Yu ZHANG, Jianguo TAN, Heping LI, Xiao WANG. Effects of cold atmosphere plasma treatment on the biological behavior of human gingival fibroblasts [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 60-67.
[4] Xiandun YUAN, Zhaohua LI, Dan XU, Ting LI, Dan FANG, Rong MU. Pathogenesis and mechanism of serine protease 23 in skin fibrosis of systemic sclerosis [J]. Journal of Peking University (Health Sciences), 2025, 57(5): 903-910.
[5] Kelin ZHAO, Xue XIA, Naixu SHI, Han ZHOU, Jingwen GAI, Ping LI. Expression and significance of ferroptosis marker 4-HNE in in vitro model of systemic sclerosis [J]. Journal of Peking University (Health Sciences), 2024, 56(6): 950-955.
[6] Shan HE,Xin CHEN,Qi CHENG,Lingjiang ZHU,Peiyu ZHANG,Shuting TONG,Jing XUE,Yan DU. Tofacitinib inhibits the transformation of lung fibroblasts into myofibroblasts through JAK/STAT3 pathway [J]. Journal of Peking University (Health Sciences), 2024, 56(3): 505-511.
[7] Yu-yang YE,Lin YUE,Xiao-ying ZOU,Xiao-yan WANG. Characteristics and microRNA expression profile of exosomes derived from odontogenic dental pulp stem cells [J]. Journal of Peking University (Health Sciences), 2023, 55(4): 689-696.
[8] TIAN Jing,QIN Man,CHEN Jie,XIA Bin. Early loss of primary molar and permanent tooth germ caused by the use of devitalizer during primary molar root canal therapy: Two cases report [J]. Journal of Peking University (Health Sciences), 2022, 54(2): 381-385.
[9] QIAN Kun,PAN Jie,ZHU Wen-hao,ZHAO Xiao-yi,LIU Chang,YONG Wei. Evaluation of bioceramic putty repairmen iRoot and mineral trioxide aggregate in mature permanent teeth pulpotomy [J]. Journal of Peking University (Health Sciences), 2022, 54(1): 113-118.
[10] GAO Hong-yu,MENG Huan-xin,HOU Jian-xia,HUANG Bao-xin,LI Wei. Expression and distribution of calprotectin in healthy and inflamed periodontal tissues [J]. Journal of Peking University (Health Sciences), 2021, 53(4): 744-749.
[11] Xiao-min GAO,Xiao-ying ZOU,Lin YUE. Mediated pathways of exosomes uptake by stem cells of apical papilla [J]. Journal of Peking University(Health Sciences), 2020, 52(1): 43-50.
[12] Jing-yi LI,Sai-nan WANG,Yan-mei DONG. Anti-inflammatory and repaired effects of non-steroidal anti-inflammatory drugs on human dental pulp cells [J]. Journal of Peking University(Health Sciences), 2020, 52(1): 24-29.
[13] Jing XIE,Yu-ming ZHAO,Nan-quan RAO,Xiao-tong WANG,Teng-jiao-zi FANG,Xiao-xia LI,Yue ZHAI,Jing-zhi LI,Li-hong GE,Yuan-yuan WANG. Comparative study of differentiation potential of mesenchymal stem cells derived from orofacial system into vascular endothelial cells [J]. Journal of Peking University(Health Sciences), 2019, 51(5): 900-906.
[14] Miao ZHENG,Ling-lu ZHAN,Zhi-qiang LIU,He-ping LI,Jian-guo TAN. Effect of different plasma treated zirconia on the adhensive behaviour of human gingival fibroblasts [J]. Journal of Peking University(Health Sciences), 2019, 51(2): 315-320.
[15] LI Shuang, ZHANG Qing. Effect of smear layer on apical sealing ability of mineral trioxide aggregate (MTA) Plus through the sucrose penetration mode [J]. Journal of Peking University(Health Sciences), 2018, 50(3): 560-563.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!