Journal of Peking University (Health Sciences) ›› 2025, Vol. 57 ›› Issue (2): 217-226. doi: 10.19723/j.issn.1671-167X.2025.02.001

    Next Articles

Exosome derived from human adipose-derived mesenchymal stem cells prevented bone loss induced by estrogen deficiency

Chunhui SHENG, Xiao ZHANG, Longwei LV*(), Yongsheng ZHOU*()   

  1. Department of Prosthodontics, Peking University School and Hospital of Stomatology & National Center for Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Research Center of Oral Biomaterials and Digi-tal Medical Devices & National Health Commission Key Laboratory of Digital Stomatology, Beijing 100081, China
  • Received:2021-11-18 Online:2025-04-18 Published:2025-04-12
  • Contact: Longwei LV, Yongsheng ZHOU E-mail:lvlw@bjmu.edu.cn;kqzhouysh@hsc.pku.edu.cn
  • Supported by:
    the Beijing Natural Science Foundation(7192228)

RICH HTML

  

Abstract:

Objective: To investigate the effect of human adipose-derived mesenchymal stem cells (hASCs) exosomes on osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) extracted from osteoporotic mice, and to evaluate the effect of hASCs exosomes on preventing bone loss induced by estrogen deficiency. Methods: hASCs exosomes were extracted by ultracentrifugation. The osteoporotic mice were established by bilateral ovariectomy (OVX). BMSCs were isolated from osteo-porotic mice and cultured for further analysis. In the experimental group, these BMSCs were exposed to an osteogenic induction medium supplemented with hASCs exosomes to evaluate their potential effects on osteogenesis. In contrast, the control group was treated with the same osteogenic induction medium, but without the addition of hASCs exosomes, to serve as a baseline comparison for the study. To comprehensively assess the osteogenic differentiation of BMSCs influenced by hASCs exosomes, alkaline phosphatase (ALP) staining, ALP activity quantitative analysis and quantitative reverse transcription polymerase chain reaction (qPCR) were performed. These evaluations provided critical insights into the role of hASCs exosomes in promoting osteoblast differentiation and bone formation in osteoporotic conditions. The fluorescence labeled hASCs exosomes were injected via the tail vein to observe the biodistribution of exosomes. Two weeks after OVX, the mice were divided into three groups: The experimental group consisted of estrogen-deficient mice receiving hASCs exosome injections; the negative control group consisted of estrogen-deficient mice receiving phosphate-buffered saline (PBS) injections; and the positive control group consisted of mice that underwent Sham surgery and received PBS injections.The injections were administered once every 3 days, for a total of 8 injections. Afterward, the femurs were collected from the mice, and micro-computed tomography (micro-CT) was performed to measure bone mineral density and conduct bone morphometric analysis. Results: hASCs exosomes were successfully extracted using ultracentrifugation. After the induction by hASCs exosomes, ALP staining and ALP activity in the BMSCs extracted from osteoporotic mice were significantly enhanced, the expression of osteogenesis related genes in BMSCs were significantly up-regulated. More trabecular bone and higher bone mineral density were observed in estrogen-deficient mice injected with hASCs exosomes compared with estrogen-deficient mice injected with PBS, and there was no significant decrease in bone mineral density compared with the Sham operation group. Conclusion: hASCs exosomes promoted the osteogenic differentiation of BMSCs extracted from osteoporotic mice. hASCs exosomes prevented bone loss induced by estrogen deficiency.

Key words: Mesenchymal stem cells, Osteogenic differentiation, Exosomes, Osteoporosis

CLC Number: 

  • R787

Table 1

Sequences of the primers used for qPCR"

Primers Forward (5′-3′) Reverse (5′-3′)
Gapdh TCACTCAAGATTGTCAGCAA AGATCCACGACGGACACATT
Alp TGACCTTCTCTCCTCCATCC CTTCCTGGGAGTCTCATCCT
Runx2 TAAGAAGAGCCAGGCAGGTG TGGCAGGTACGTGTGGTAGT
Ocn TGCTTGTGACGAGCTATCAG GAGGACAGGGAGGATCAAGT

Figure 1

Characterization of hASCs derived exosomes A, microscopic morphology of hASCs derived exosomes under TEM; B, the size distribution of hASCs derived exosomes measured by NTA; C, Western blot analysis of the exosomal markers, β-tubulin was a negative marker protein. hASCs, human adipose-derived mesenchymal stem cells; TEM, transmission electron microscopy; NTA, nanoparticle tracking analysis."

Figure 2

hASCs exosomes promoted osteogenic differentiation of mBMSCs A, ALP staining on day 3 and day 7; B, expression of osteogenic genes Runx2, Alp, and Ocn in mBMSCs cultured with hASCs exosomes on day 3 and days 7. * *P < 0.01. OM, osteogenic induction medium; EXO, exosomes; hASCs, human adipose-derived mesenchymal stem cells; mBMSCs, mouse bone marrow mesenchymal stem cells; ALP, alkaline phosphatase."

Figure 3

Biodistribution of hASCs exosomes in mice A, the radiant efficiency in hearts, lungs, spleens, livers, kidneys and femurs at 12, 24 and 48 h; B, quantitative analysis of radiant efficiency in femurs at 12, 24 and 48 h; C, the variation of radiant efficiency with time in hearts, lungs, spleens, livers, kidneys and femurs. * *P < 0.01. PBS, phosphate buffered saline; EXO, exosomes; hASCs, human adipose-derived mesenchymal stem cells."

Figure 4

hASCs exosomes prevented bone loss caused by OVX A, micro-CT images and 3D reconstructed images of femurs after treatment of hASCs exosomes; B, HE and Masson staining of mouse femurs after treatment of hASCs exosomes; C, BMD and bone morphometric analyses of mouse femurs after treatment of hASCs exosomes. *P < 0.05, * *P < 0.01. OVX, ovariectomy; PBS, phosphate buffered saline; EXO, exosomes; HE, hematoxylin and eosin; hASCs, human adipose-derived mesenchymal stem cells; BMD, bone mineral density; BV/TV, bone volume/total volume; BS/BV, bone surface area/bone volume; TbN, Trabecular number; TbTh, trabecular thickness; TbSp, trabecular spacing; ns, no significance."

1 Brown C . Osteoporosis: Staying strong[J]. Nature, 2017, 550 (7674): 15- 17.
doi: 10.1038/nature.2017.22694
2 中华医学会骨质疏松和骨矿盐疾病分会. 中国骨质疏松症流行病学调查及"健康骨骼"专项行动结果发布[J]. 中华骨质疏松和骨矿盐疾病杂志, 2019, 12 (4): 317- 318.
doi: 10.3969/j.issn.1674-2591.2019.04.001
3 Kerschan-Schindl K . Prevention and rehabilitation of osteoporosis[J]. Wien Med Wochenschr, 2016, 166 (1/2): 22- 27.
4 Harvey NC , McCloskey E , Kanis JA , et al. Bisphosphonates in osteoporosis: NICE and easy?[J]. Lancet, 2017, 390 (10109): 2243- 2244.
5 Rossouw JE , Anderson GL , Prentice RL , et al. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: Principal results from the Women' s Health Initiative randomized controlled trial[J]. JAMA, 2002, 288 (3): 321- 333.
doi: 10.1001/jama.288.3.321
6 Phetfong J , Sanvoranart T , Nartprayut K , et al. Osteoporosis: The current status of mesenchymal stem cell-based therapy[J]. Cell Mol Biol Lett, 2016, 21, 12.
doi: 10.1186/s11658-016-0013-1
7 Berkowitz AL , Miller MB , Mir SA , et al. Glioproliferative lesion of the spinal cord as a complication of "stem-cell tourism"[J]. N Engl J Med, 2016, 375 (2): 196- 198.
doi: 10.1056/NEJMc1600188
8 Sadat-Ali M , Al-Dakheel DA , Al-Mousa SA , et al. Stem-cell therapy for ovariectomy-induced osteoporosis in rats: A comparison of three treatment modalities[J]. Stem Cells Cloning, 2019, 12, 17- 25.
9 Liew LC , Katsuda T , Gailhouste L , et al. Mesenchymal stem cell-derived extracellular vesicles: A glimmer of hope in treating Alzheimer' s disease[J]. Int Immunol, 2017, 29 (1): 11- 19.
doi: 10.1093/intimm/dxx002
10 Li G , Zhang Y , Wu J , et al. Adipose stem cells-derived exosomes modified gelatin sponge promotes bone regeneration[J]. Front Bioeng Biotechnol, 2023, 11, 1096390.
11 Soleimani M , Nadri S . A protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow[J]. Nat Protoc, 2009, 4 (1): 102- 106.
doi: 10.1038/nprot.2008.221
12 Luo ZW , Li FX , Liu YW , et al. Aptamer-functionalized exosomes from bone marrow stromal cells target bone to promote bone regeneration[J]. Nanoscale, 2019, 11 (43): 20884- 20892.
doi: 10.1039/C9NR02791B
13 Chen S , Zheng Y , Zhang S , et al. Promotion effects of miR-375 on the osteogenic differentiation of human adipose-derived mesenchymal stem cells[J]. Stem Cell Reports, 2017, 8 (3): 773- 786.
doi: 10.1016/j.stemcr.2017.01.028
14 Lv L , Ge W , Liu Y , et al. Lysine-specific demethylase 1 inhibitor rescues the osteogenic ability of mesenchymal stem cells under osteoporotic conditions by modulating H3K4 methylation[J]. Bone Res, 2016, 4, 16037.
doi: 10.1038/boneres.2016.37
15 Li L , Wang Z . Ovarian aging and osteoporosis[J]. Adv Exp Med Biol, 2018, 1086, 199- 215.
16 Garnero P , Chapuy MC , Pierre D . Increased bone turnover in late postmenopausal women is a major determinant of osteoporosis[J]. J Bone Miner Res, 1996, 11 (3): 337- 349.
doi: 10.1002/jbmr.5650110307
17 Shen G , Ren H , Shang Q , et al. Foxf1 knockdown promotes BMSC osteogenesis in part by activating the Wnt/beta-catenin signalling pathway and prevents ovariectomy-induced bone loss[J]. EBioMedicine, 2020, 52, 102626.
doi: 10.1016/j.ebiom.2020.102626
18 Prockop DJ . Marrow stromal cells as stem cells for nonhemato-poietic tissues[J]. Science, 1997, 276 (5309): 71- 74.
doi: 10.1126/science.276.5309.71
19 Pittenger MF , Mackay AM , Beck SC , et al. Multilineage potential of adult human mesenchymal stem cells[J]. Science, 1999, 284 (5411): 143- 147.
doi: 10.1126/science.284.5411.143
20 Li W , Liu Y , Zhang P , et al. Tissue-engineered bone immobilized with human adipose stem cells-derived exosomes promotes bone regeneration[J]. ACS Appl Mater Interfaces, 2018, 10 (6): 5240- 5254.
doi: 10.1021/acsami.7b17620
21 Huang T , Yu Z , Yu Q , et al. Inhibition of osteogenic and adipogenic potential in bone marrow-derived mesenchymal stem cells under osteoporosis[J]. Biochem Biophys Res Commun, 2020, 525 (4): 902- 908.
22 Mohamed-Ahmed S , Fristad I , Lie SA , et al. Adipose-derived and bone marrow mesenchymal stem cells: A donor-matched comparison[J]. Stem Cell Res Ther, 2018, 9 (1): 168.
doi: 10.1186/s13287-018-0914-1
23 Ibrahim A , Marban E . Exosomes: Fundamental biology and roles in cardiovascular physiology[J]. Annu Rev Physiol, 2016, 78, 67- 83.
doi: 10.1146/annurev-physiol-021115-104929
24 Zhou Y , Xu H , Xu W , et al. Exosomes released by human umbilical cord mesenchymal stem cells pr otect against cisplatin-induced renal oxidati ve stress and apoptosis in vivo and in vitro[J]. Stem Cell Res Ther, 2013, 4 (2): 34.
doi: 10.1186/scrt194
25 Zhang B , Wang M , Gong A , et al. HucMSC-exosome mediated-Wnt4 signaling is required for cutaneous wound healing[J]. Stem Cells, 2015, 33 (7): 2158- 2168.
doi: 10.1002/stem.1771
26 Zuo R , Liu M , Wang Y , et al. BM-MSC-derived exosomes alle-viate radiation-induced bone loss by restoring the function of recipient BM-MSCs and activating Wnt/beta-catenin signaling[J]. Stem Cell Res Ther, 2019, 10 (1): 30.
27 Yang BC , Kuang MJ , Kang JY , et al. Human umbilical cord mesenchymal stem cell-derived exosomes act via the miR-1263/Mob1/Hippo signaling pathway to prevent apoptosis in disuse osteoporosis[J]. Biochem Biophys Res Commun, 2020, 524 (4): 883- 889.
28 Wang X , Omar O , Vazirisani F , et al. Mesenchymal stem cell-derived exosomes have altered microRNA profiles and induce osteogenic differentiation depending on the stage of differentiation[J]. PLoS One, 2018, 13 (2): e0193059.
29 Liu T , Hu W , Zou X , et al. Human periodontal ligament stem cell-derived exosomes promote bone regeneration by altering microRNA profiles[J]. Stem Cells Int, 2020, 2020, 8852307.
30 Wang L , Pan Y , Liu M , et al. Wen-Shen-Tong-Luo-Zhi-Tong Decoction regulates bone-fat balance in osteoporosis by adipocyte-derived exosomes[J]. Pharm Biol, 2023, 61 (1): 568- 580.
31 Wiklander OP , Nordin JZ , O' Loughlin A , et al. Extracellular vesicle in vivo biodistribution is determined by cell source, route of administration and targeting[J]. J Extracell Vesicles, 2015, 4, 26316.
32 Song H , Li X , Zhao Z , et al. Reversal of osteoporotic activity by endothelial cell-secreted bone targeting and biocompatible exosomes[J]. Nano Lett, 2019, 19 (5): 3040- 3048.
[1] Xiaoqiang BAI, Zhiruo YUAN, Yongsheng ZHOU, Longwei LV. Dynamic stretching promotes osteogenic differentiation of human bone marrow mesenchymal stem cells in three-dimensional culture [J]. Journal of Peking University (Health Sciences), 2026, 58(3): 641-649.
[2] Han ZHANG, Fujia YANG, Ruili YANG. Progress in regulating stem cell functions for repair and regeneration of craniomaxillofacial tissues [J]. Journal of Peking University (Health Sciences), 2026, 58(2): 285-289.
[3] Liting ZENG, Kaiyuan CHENG, Zhongning LIU, Jian LI, Jingwen YANG, Ting JIANG. miR-488-5p promotes osteogenic and neurogenic differentiation of rat bone marrow mesenchymal stem cells and enhances neuralized bone regeneration [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 10-21.
[4] Congyi YANG, Xiaowen ZHENG, Jingyi CHEN, Jun XU, Feng CHEN, Yang CHEN, Ning CHEN. Protein biomarker screening and functional analysis of salivary exosomes in patients with ulcerative colitis [J]. Journal of Peking University (Health Sciences), 2025, 57(5): 895-902.
[5] Ju YANG, Yue LIU, Chunna QU, Jianbin SUN, Tianying LI, Lianjie SHI. Bisphosphonates-related osteonecrosis of the jaw: A case report [J]. Journal of Peking University (Health Sciences), 2025, 57(2): 388-392.
[6] Ting SHUAI, Yanyan GUO, Chunping LIN, Xiaomei HOU, Chanyuan JIN. Knockdown of NPTX1 promotes osteogenic differentiation of human bone marrow mesenchymal stem cells [J]. Journal of Peking University (Health Sciences), 2025, 57(1): 7-12.
[7] Yibo HU, Weijia LYU, Wei XIA, Yihong LIU. Hydrodynamic finite element analysis of biological scaffolds with different pore sizes for cell growth and osteogenic differentiation [J]. Journal of Peking University (Health Sciences), 2025, 57(1): 97-105.
[8] Zhihui WU, Mingzhi HU, Qiaoying ZHAO, Fengfeng LV, Jingying ZHANG, Wei ZHANG, Yongfu WANG, Xiaolin SUN, Hui WANG. Immunomodulatory mechanism of umbilical cord mesenchymal stem cells modified by miR-125b-5p in systemic lupus erythematosus [J]. Journal of Peking University (Health Sciences), 2024, 56(5): 860-867.
[9] Xinzhu BAI,Jinhui HE,Songsong LU,Chun LI,Yilin WANG,Jian XIONG. Vertebral fractures combined with prolonged activated partial prothrombin time: A case report [J]. Journal of Peking University (Health Sciences), 2024, 56(2): 371-374.
[10] Wen-gen LI,Xiao-dong GU,Rui-qiang WENG,Su-dong LIU,Chao CHEN. Expression and clinical significance of plasma exosomal miR-34-5p and miR-142-3p in systemic sclerosis [J]. Journal of Peking University (Health Sciences), 2023, 55(6): 1022-1027.
[11] Da-wei WANG,Hua-dong WANG,Li LI,Xin YIN,Wei HUANG,Ji-dong GUO,Ya-feng YANG,Yi-hao LIU,Yang ZHENG. Efficacy analysis of autologous facet joint bone block in lumbar interbody fusion of osteoporosis patients [J]. Journal of Peking University (Health Sciences), 2023, 55(5): 899-909.
[12] Yu-yang YE,Lin YUE,Xiao-ying ZOU,Xiao-yan WANG. Characteristics and microRNA expression profile of exosomes derived from odontogenic dental pulp stem cells [J]. Journal of Peking University (Health Sciences), 2023, 55(4): 689-696.
[13] Chao HAN,Zhu-xing ZHOU,You-rong CHEN,Zi-hui DONG,Jia-kuo YU. Biological characteristics of sheep peripheral blood mesenchymal stem cell [J]. Journal of Peking University (Health Sciences), 2022, 54(6): 1151-1157.
[14] SHUAI Ting,LIU Juan,GUO Yan-yan,JIN Chan-yuan. Knockdown of long non-coding RNA MIR4697 host gene inhibits adipogenic differentiation in bone marrow mesenchymal stem cells [J]. Journal of Peking University (Health Sciences), 2022, 54(2): 320-326.
[15] PANG Yong,ZHANG Sha,YANG Hua,ZHOU Rou-li. Serum LAPTM4B-35 protein as a novel diagnostic marker for hepatocellular carcinoma [J]. Journal of Peking University (Health Sciences), 2021, 53(4): 710-715.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!