Email Alert | RSS

Journal of Peking University(Health Sciences) ›› 2019, Vol. 51 ›› Issue (1): 28-34. doi: 10.19723/j.issn.1671-167X.2019.01.006

Previous Articles     Next Articles

Effects of electrospun collagen nanofibrous matrix on the biological behavior of human dental pulp cells

Qian-li ZHANG1,Chong-yang YUAN1,Li LIU2,Shi-peng WEN2,△(),Xiao-yan WANG1,△()   

  1. 1. Department of Cariology and Endodontology, Peking University School and Hospital of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
    2. Beijing Engineering Research Centre of Advanced Elastomers, Beijing University of Chemical Technology, Beijing 100029, China
  • Received:2018-10-10 Online:2019-02-18 Published:2019-02-26
  • Contact: Shi-peng WEN,Xiao-yan WANG E-mail:wensp@mail.buct.edu.cn;wangxiaoyan@pkuss.bjmu.edu.cn
  • Supported by:
    Supported by the National Natural Science Foundation of China(51503004)

RICH HTML

   

PDF (PC)

Abstract:

Objective: To compare cell adhesion, proliferation and odontoblastic differentiation of human dental pulp cells (hDPCs) on electrospun collagen nanofibrous matrix (Col_NFM) with that on collagen flat film (Col-FF), to investigate the biological effect of collagen nanofibrous matrix on hDPCs. Methods: The surface morphology of the two different collagen scaffold was analyzed by scanning electron microscopy (SEM), and the contact angle and the swelling ratio were also measured. Then hDPCs were implanted on the two different collagen scaffolds, the cell morphology was observed using SEM and laser scanning microscope (LSM), and cell proliferation was evaluated by the CCK-8 assay. After hDPCs cultured on the two different collagen scaffold with odontoblastic medium for 14 days, the expression of odontoblastic differentiation related genes was detected by real-time PCR, and alizarin red staining was used to test the formation of mineralized nodules. Results: From the SEM figures, the fibers’ diameter of Col_NFM was (884±159) nm, and there were abundant three dimensional connected pore structures between the fibers of Col_NFM, while the surface of Col_FF was completely flat without pore structure. The contact angle at 0 s of Col_NFM was 85.03°±4.45°, and that of Col_FF was 98.98°±5.81°. The swelling ratio of Col_NFM was approximately 3 folds compared with dry weight sample, while that of Col_FF was just 1 fold. Thus Col_NFM indicated better hydrophilicity and swelling property. SEM and LSM showed that hDPCs on Col_NFM presented an irregular and highly branched phenotype, and could penetrate into the nanofibrous scaffold. In contrast, the cells were spread only on the surface of Col_FF with a spindle-shaped morphology. CCK-8 assays showed that hDPCs on Col_NFM showed higher proliferation rate than on Col_FF. After hDPCs were cultured on the two different collagen scaffolds with odontoblastic medium for 14 days, more expressions of odontoblastic differentiation related genes, such as dentin sialophosphoprotein (DSPP) and dentin matrix proten-1 (DMP1) were determined in Col_NFM group (P<0.05), and more mineralization depositions were also observed in Col_NFM group according to the results of alizarin red staining. Conclusion: Col_NFM with nanoscale microstructure achieves better hydrophilic and swelling properties than Col_FF, and hDPCs cultured with Col_NFM present higher activity on cell adhesion, proliferation and odontoblastic differentiation.

Key words: Collagen, Electrospinning, Pulp regeneration, Nanofibers, Scaffold

CLC Number: 

  • R781.3

Table 1

The chain of reaction primers"

Gene Gene sequence (5'-3')
DSPP Forward: ATATTGAGGGCTGGAATGGGGA
Reverse: TTTGTGGCTCCAGCATTGTCA
DMP1 Forward: AGGAAGTCTCGCATCTCAGAG
Reverse: TGGAGTTGCTGTTTTCTGTAGAG
GAPDH Forward: GAAGGTGAAGGTCGGAGTC
Reverse: GAGATGGTGATGGGATTTC

Figure 1

Scanning electron microscopy view of the scaffolds A,Col_NFM group; B, Col_FF group."

Figure 2

Contact angles of the scaffolds A,Col_NFM group, 0 s; B, Col_NFM group, 8 s; C, Col_FF group, 0 s; D, Col_FF group, 8 s."

Figure 3

Swelling ratio of the scaffolds *P<0.05, compared with the Col_FF group at the same time."

Figure 4

Scanning electron microscopy view of hDPCs cultured on different surfaces A, B, Col_NFM group; C, D, Col_FF group. B and D were the red box region view of A and C at high magnification."

Figure 5

Laser scanning microscope view of hDPCs cultured on different surfaces A, B, Col_NFM group; C, Col_FF group."

Figure 6

The proliferation of hDPCs on different scaffolds *P<0.05, compared with the Col_FF group at the same time."

Figure 7

Quantitative real-time PCR analysis of DSPP and DMP1 gene expression of hDPCs for 14 days *P<0.05, compared with the control group; # P<0.05, compared with the Col_FF group. Abbreviations as in Table 1."

Figure 8

Alizarin red staining of hDPCs cultured on different scaffolds at day 14"

[1] Lysaght MJ, Reyes J . The growth of tissue engineering[J]. Tissue Eng, 2001,7(5):485-493.
doi: 10.1089/107632701753213110 pmid: 11694183
[2] Malhotra N, Kundabala M, Acharya S. Current strategies and applications of tissue engineering in dentistry: a review part 1 [J]. Dent Update, 2009, 36(9): 577- 579, 581-582.
pmid: 20099610
[3] Wiesmann HP, Meyer U, Plate U , et al. Aspects of collagen mineralization in hard tissue formation[J]. Int Rev Cytol, 2005,242:121-156.
doi: 10.1016/S0074-7696(04)42003-8 pmid: 15598468
[4] Sumita Y, Honda MJ, Ohara T , et al. Performance of collagen sponge as a 3-D scaffold for tooth-tissue engineering[J]. Biomaterials, 2006,27(17):3238-3248.
doi: 10.1016/j.biomaterials.2006.01.055 pmid: 16504285
[5] Prescott RS, Alsanea R, Fayad MI , et al. In vivo generation of dental pulp-like tissue by using dental pulp stem cells, a collagen scaffold, and dentin matrix protein 1 after subcutaneous transplantation in mice[J]. J Endod, 2008,34(4):421-426.
doi: 10.1016/j.joen.2008.02.005 pmid: 18358888
[6] Kim NR, Lee DH, Chung PH , et al. Distinct differentiation pro-perties of human dental pulp cells on collagen, gelatin, and chitosan scaffolds[J]. Oral Surg Oral Med Oral Pathol Oral Radiol Endod, 2009,108(5):94-100.
doi: 10.1016/j.tripleo.2009.07.031 pmid: 19836718
[7] Strom SC, Michalopoulos G . Collagen as a substrate for cell growth and differentiation[J]. Methods Enzymol, 1982,82(Pt A):544-555.
doi: 10.1016/0076-6879(82)82086-7
[8] Grinnell F, Bennett MH . Ultrastructural studies of cell: collagen interactions[J]. Methods Enzymol, 1982,82(Pt A):535-544.
doi: 10.1016/0076-6879(82)82085-5
[9] Elsdale T, Bard J . Collagen substrata for studies on cell behavior[J]. J Cell Biol, 1972,54(3):626-637.
doi: 10.1083/jcb.54.3.626
[10] Woo KM, Chen VJ, Ma PX . Nano-fibrous scaffolding architecture selectively enhances protein adsorption contributing to cell attachment[J]. J Biomed Mater Res A, 2003,67(2):531-537.
doi: 10.1002/jbm.a.10098 pmid: 14566795
[11] Wang J, Ma H, Jin X , et al. The effect of scaffold architecture on odontogenic differentiation of human dental pulp stem cells[J]. Biomaterials, 2011,32(31):7822-7830.
doi: 10.1016/j.biomaterials.2011.04.034 pmid: 3159766
[12] Kuang R, Zhang Z, Jin X , et al. Nanofibrous spongy microspheres enhance odontogenic differentiation of human dental pulp stem cells[J]. Adv Healthc Mater, 2015,4(13):1993-2000.
doi: 10.1002/adhm.201500308 pmid: 26138254
[13] Kwon YS, Lee SH, Hwang YC , et al. Behaviour of human dental pulp cells cultured in a collagen hydrogel scaffold cross-linked with cinnamaldehyde[J]. Int Endod J,2017,50(1):58-66.
doi: 10.1111/iej.12592 pmid: 26650820
[14] Coyac BR, Chicatun F, Hoac B , et al. Mineralization of dense collagen hydrogel scaffolds by human pulp cells[J]. J Dent Res, 2013,92(7):648-654.
doi: 10.1177/0022034513488599 pmid: 23632809
[15] Pan S, Dangaria S, Gopinathan G , et al. SCF promotes dental pulp progenitor migration, neovascularization, and collagen remo-deling: potential applications as a homing factor in dental pulp regeneration[J]. Stem Cell Rev, 2013,9(5):655-667.
doi: 10.1007/s12015-013-9442-7 pmid: 23703692
[16] Kim JJ, Bae WJ, Kim JM , et al. Mineralized polycaprolactone nanofibrous matrix for odontogenesis of human dental pulp cells[J]. J Biomater Appl, 2014,28(7):1069-1078.
doi: 10.1177/0885328213495903
[17] Liu H, Ding X, Zhou G , et al. Electrospinning of nanofibers for tissue engineering applications[J]. J Nanomater, 2013,47(2013):63-72.
doi: 10.1155/2013/495708
[18] Huang GT, Gronthos S, Shi S . Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine[J]. J Dent Res, 2009,88(9):792-806.
doi: 10.1177/0022034509340867 pmid: 2830488
[19] Kumar G, Tison CK, Chatterjee K , et al. The determination of stem cell fate by 3D scaffold structures through the control of cell shape[J]. Biomaterials, 2011,32(35):9188-9196.
doi: 10.1016/j.biomaterials.2011.08.054 pmid: 3428125
[20] Chen CS, Mrksich M, Huang S , et al. Geometric control of cell life and death[J]. Science, 1997,276(5317):1425-1428.
doi: 10.1126/science.276.5317.1425
[21] Folkman J, Moscona A . Role of cell shape in growth control[J]. Nature, 1978,273(5661):345-349.
[22] McBeath R, Pirone DM, Nelson CM , et al. Cell shape, cytoske-letal tension, and RhoA regulate stem cell lineage commitment[J]. Developmental Cell, 2004,6(4):483-495.
doi: 10.1016/S1534-5807(04)00075-9
[23] Lee JH, Lee JW, Khang G , et al. Interaction of cells on chargeable functional group gradient surfaces[J]. Biomaterials, 1997,18(4):351-358.
doi: 10.1016/S0142-9612(96)00128-7
[24] Khorasani MT, Mirzadeh H, Irani S . Plasma surface modification of poly (-lactic acid) and poly (lactic-co-glycolic acid) films for improvement of nerve cells adhesion[J]. Radiat Phys Chem, 2008,77(3):280-287.
doi: 10.1016/j.radphyschem.2007.05.013
[1] Deng-hui DUAN,Hom-Lay WANG,En-bo WANG. Role of collagen membrane in modified guided bone regeneration surgery using buccal punch flap approach: A retrospective and radiographical cohort study [J]. Journal of Peking University (Health Sciences), 2023, 55(6): 1097-1104.
[2] Lei WANG,Xiang-shu JIN,Hui-jun DONG,Guo-min OU,Xin-yuan LAI,Hui ZHUANG,Tong LI,Kuan-hui XIANG. Establishment of a reporter system for estimating activation of human hepatic stellate cells based on COL1A1 promoter and enhanced green fluorescent protein [J]. Journal of Peking University (Health Sciences), 2023, 55(5): 876-885.
[3] Yu-ke LI,Mei WANG,Lin TANG,Yu-hua LIU,Xiao-ying CHEN. Effect of pH on the chelation between strontium ions and decellularized small intestinal submucosal sponge scaffolds [J]. Journal of Peking University (Health Sciences), 2023, 55(1): 44-51.
[4] Yi DENG,Yi ZHANG,Bo-wen LI,Mei WANG,Lin TANG,Yu-hua LIU. Effects of different crosslinking treatments on the properties of decellularized small intestinal submucosa porous scaffolds [J]. Journal of Peking University (Health Sciences), 2022, 54(3): 557-564.
[5] MA Xin-rong,ZHU Xiao-ming,LI Jing,LI De-li,LI He-ping,TAN Jian-guo. Effect of a novel radio-frequency atmospheric-pressure glow discharge plasma jet treatment on crosslinking of dentin collagen [J]. Journal of Peking University (Health Sciences), 2022, 54(1): 83-88.
[6] Chun-ling CAO,Cong-chong YANG,Xiao-zhong QU,Bing HAN,Xiao-yan WANG. Effects of the injectable glycol-chitosan based hydrogel on the proliferation and differentiation of human dental pulp cells [J]. Journal of Peking University(Health Sciences), 2020, 52(1): 10-17.
[7] Ping WANG,Jing SONG,Xiang-yu FANG,Xin LI,Xu LIU,Yuan JIA,Zhan-guo LI,Fan-lei HU. Role of erythroblast-like Ter cells in the pathogenesis of collagen-induced arthritis [J]. Journal of Peking University(Health Sciences), 2019, 51(3): 445-450.
[8] Xiao-ming ZHU,Xuan QI,De-li LI,Yu-wei ZHANG,He-ping LI,Jian-guo TAN. Effect of a novel cold atmospheric plasma jet treatment with different temperatures on resin-dentin bonding [J]. Journal of Peking University(Health Sciences), 2019, 51(1): 43-48.
[9] Rong LI,Ke-long CHEN,Yong WANG,Yun-song LIU,Yong-sheng ZHOU,Yu-chun SUN. Establishment of a 3D printing system for bone tissue engineering scaffold fabrication and the evaluation of its controllability over macro and micro structure precision [J]. Journal of Peking University(Health Sciences), 2019, 51(1): 115-119.
[10] ZHANG Hui, LI Liang, WANG Qian, GAN Hong-Quan, WANG Hui, BI Cheng, LI Qi-Jia, WANG Zhi-Qiang. Influence of BMP-7 on chondrocyte secretion and expression of Col-Ⅱ，AGG and Sox9 mRNA in porous tantalum-chondrocyte composites in vitro [J]. Journal of Peking University(Health Sciences), 2015, 47(2): 219-225.
[11] 欧Meng-恩 , ZHANG Xiao, LIU Yun-Song, GE Yan-Jun, ZHOU Yong-Sheng. Ectopic osteogenesis of stromal cell-derived factor 1 combined with simvastatin loaded collagen scaffold in vivo [J]. Journal of Peking University(Health Sciences), 2015, 47(1): 47-51.
[12] LIU Yan, FU Yu, LIU Shuai, ZHOU Yan-heng. Effects of microstructure of mineralized collagen scaffolds on cell morphology of MG 63 [J]. Journal of Peking University(Health Sciences), 2014, 46(1): 19-24.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Copyright © Journal of Peking University (Health Sciences), All Rights Reserved.
Powered by Beijing Magtech Co. Ltd