Journal of Peking University(Health Sciences) ›› 2020, Vol. 52 ›› Issue (1): 10-17. doi: 10.19723/j.issn.1671-167X.2020.01.002

Previous Articles     Next Articles

Effects of the injectable glycol-chitosan based hydrogel on the proliferation and differentiation of human dental pulp cells

Chun-ling CAO1,Cong-chong YANG1,Xiao-zhong QU2,Bing HAN1,(),Xiao-yan WANG1,()   

  1. 1. Department of Cariology and Endodontology, Peking University School and Hospital of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
    2. College of Materials Science and Opto-electronic Technology, University of Chinese Academy of Sciences, Beijing 100049, China
  • Received:2019-10-10 Online:2020-02-18 Published:2020-02-20
  • Contact: Bing HAN,Xiao-yan WANG E-mail:hanbing822@126.com;wangxiaoyan@pkuss.bjmu.edu.cn
  • Supported by:
    Supported by the National Natural Science Foundation of China(81771061);Supported by the National Natural Science Foundation of China(81400562)

RICH HTML

  

Abstract:

Objective: To prepare glycol-chitosan (GC)-based single /dual-network hydrogels with different composition ratios (GC31, DN3131 and DN6262) and to investigate the effects of hydrogel scaffolds on biological behavior of human dental pulp cell (hDPC) encapsulated. Methods: GC-based single-network hydrogels (GC31) and GC-based dual-network hydrogels (DN3131, DN6262) with different composition ratios were prepared. The injectability was defined as the average time needed to expel a certain volume of hydrogel under a constant force. The degradation of the hydrogel was determined by the weight loss with time. The fracture stress was measured using a universal testing machine. The proliferation of hDPCs in hydrogels was detected using the cell counting kit-8 (CCK-8) method and Calcein-AM/PI Live/Dead assay. After 14 days of odontoblastic induction, the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP) and dentin matrix protein-1 (DMP-1) was detected by real-time quantitative reverse transcription PCR (real-time RT-PCR) and the mineralized nodules was observed by Von Kossa staining. Results: The injectability of all three groups of hydrogels was acceptable. The time of injection of GC31 was the shortest, and that of DN6262 was longer than DN3131 (P<0.05). The degradation rate of GC31 hydrogel in vitro was significantly faster than that of the dual-network hydrogel groups (P<0.05). There was no significant difference between DN3131 and DN6262 (P>0.05). The compressive resistance failure point of GC31 group was 1.10 kPa, while it was 7.33 kPa and 43.30 kPa for DN3131 and DN6262. The compressive strength of dual-network hydrogel was significantly enhanced compared with single-network hydrogel. hDPCs were in continuous proliferation in all the three groups,and the GC31 group showed a higher proliferation rate (P<0.05). The expression levels of DSPP, DMP-1 and ALP in the dual-network hydrogel groups (DN3131, DN6262) were significantly higher than that of GC31 after culturing for 14 days (P<0.05), there was no difference in the expression levels of DMP-1 and ALP between DN3131 and DN6262 (P>0.05); Von Kossa staining showed that more mineralization deposition and mass-shaped mineralized nodules formed in DN3131 and DN6262, while only light brown calcium deposition staining was observed in GC31 group, which was scattered in granular forms. Conclusion: GC-based single/dual network hydrogels with different composition ratios met the injectable requirements. GC31 group had a lower mechanical properties, in which hDPCs exhibited a higher proliferation rate. Dual-network hydrogels had slower degradation rate and higher mechanical properties, in which hDPCs exhibited better odontoblastic differentiation potential and mineralization potential.

Key words: Hydrogel, Pulp regeneration, Scaffold, Dual-network hydrogel

CLC Number: 

  • R783.1

Table 1

Component concentration of each group"

Group
abbreviation
GC Component concentration/%
OHC-PEO-CHO Alg CaCl2
GC31 3 1 - -
DN3131 3 1 3 1
DN6262 6 2 6 2

Figure 1

Preparation and utilization of three GC-based hydrogels as three-dimensional (3D) scaffolds for culture of hDPCs"

Table 2

The chain of reaction primers"

Gene Gene sequence (5' to 3')
DSPP Forward: ATATTGAGGGCTGGAATGGGGA
Reverse: TTTGTGGCTCCAGCATTGTCA
DMP-1 Forward: AGGAAGTCTCGCATCTCAGAG
Reverse: TGGAGTTGCTGTTTTCTGTAGAG
β-actin Forward: CATGTACGTTGCTATCCAGGC
Reverse: CCATCCAATCGGTAGTAGCG
ALP Forward: AGCACTCCCACTTCATCTGGAA
Reverse: GAGACCCAATAGGTAGTCCACATTG

Figure 2

The hydrogel formed a cylinder shape using 48-wells plate as a mold"

Figure 3

Demonstration of the injection of hydrogel into root canal mold through a connected mixing syringe of 21G needle"

Figure 4

Injectability of GC-based hydrogels *P<0.05."

Figure 5

Compressive stress-strain curve of hydrogels A, GC31; B, DN3131; C, DN6262."

Figure 6

Degradation observation of hydrogels A, residual weight of GC31, DN3131, DN6262 hydrogels within 3 weeks; B, remaining size of hydrogels within 3 weeks in vitro. * P<0.05, compared with GC31."

Figure 7

The proliferation of hDPCs cultured in GC-based hydrogels A, CCK-8 assay in hydrogels; B, images of live/dead assay staining of hDPCs in 3D hydrogel scaffolds for different culture time (living cells: green, dead cells: red). * P<0.05, compared with DN6262, # P<0.05, compared with DN3131. Images were taken at ×100 magnification."

Figure 8

Quantitative determination of mRNA expression of ondontoblastic differentiation marker genes (DMP-1, DSPP, ALP) by real-time RT-PCR * P<0.05."

Figure 9

Von Kossa staining of histologic sections for hDPCs cultured in GC-based hydrogels in vitro"

[1] 孙艳艳, 袁梦桐, 胡伟平 . 牙髓干细胞的研究与应用[J]. 实用口腔医学杂志, 2016,32(3):426-429.
[2] Xuan K, Li B, Guo H , et al. Deciduous autologous tooth stem cells regenerate dental pulp after implantation into injured teeth[J]. Sci Trans Med, 2018,10(455):3227.
[3] Galler KM, Hartgerink JD, Cavender A C , et al. A customized self-assembling peptide hydrogel for dental pulp tissue engineering[J]. Tissue Eng Part A, 2012,18(1/2):176-184.
[4] Qu T, Jing J, Ren Y , et al. Complete pulpodentin complex re-generation by modulating the stiffness of biomimetic matrix[J]. Acta Biomater, 2015,16(1):60-70.
[5] Smith JG, Smith AJ, Shelton RM , et al. Dental pulp cell behavior in biomimetic environments[J]. J Dent Res, 2015,94(11):1552-1559.
[6] Gillette BM, Jensen JA, Wang M , et al. Dynamic hydrogels: switching of 3D microenvironments using two-component naturally derived extracellular matrices[J]. Adv Mater, 2010,22(6):686-691.
[7] Xu X, Gu Z, Chen X , et al. An injectable and thermosensitive hydrogel: Promoting periodontal regeneration by controlled-release of aspirin and erythropoietin[J]. Acta Biomater, 2019,86:235-246.
[8] Yan Y, Li M, Yang D , et al. Construction of injectable double-network hydrogels for cell delivery[J]. Biomacromolecules, 2017,18(7):2128-2138.
[9] Lee KY, Mooney DJ . Hydrogels for tissue engineering[J]. Chem Rev, 2001,101(7):1869-1880.
[10] Jones TD, Kefi A, Sun S, et al. An optimized injectable hydrogel scaffold supports human dental pulp stem cell viability and spreading[J/OL]. Adv Med, 2016, 2016: 7363579(2016-05-16)[2019-09-01]. .
[11] Her GJ, Wu H, Chen M , et al. Control of three-dimensional substrate stiffness to manipulate mesenchymal stem cell fate toward neuronal or glial lineages[J]. Acta Biomater, 2013,9(2):5170-5180.
[12] Slaughter BV, Khurshid SS, Fisher OZ , et al. Hydrogels in regenerative medicine[J]. Adv Mater, 2009,21(32/33):3307-3329.
[13] Dash M, Chiellini F, Ottenbrite RM , et al. Chitosan: a versatile semi-synthetic polymer in biomedical applications[J]. Prog Polym Sci, 2011,36(8):981-1014.
[14] Zou H, Wang G, Song F , et al. Investigation of human dental pulp cells on a potential injectable poly(lactic-co-glycolic acid) microsphere scaffold[J]. J Endod, 2017,43(5):745-750.
[15] Chrepa V, Austah O, Diogenes A . Evaluation of a commercially available hyaluronic acid hydrogel (restylane) as injectable scaffold for dental pulp regeneration: an in vitro evaluation[J]. J Endod, 2017,43(2):257-262.
[16] Yu L, Ding J . Injectable hydrogels as unique biomedical materials[J]. Chem Soc Rev, 2008,37(8):1473.
[17] Malda J, Visser J, Melchels FP , et al. 25th anniversary article: engineering hydrogels for biofabrication[J]. Adv Mater, 2013,25(36):5011-5028.
[18] Smith LR, Cho S, Discher DE . Stem cell differentiation is regu-lated by extracellular matrix mechanics[J]. Physiology, 2018,33(1):16-25.
[19] Sun TL, Kurokawa T, Kuroda S , et al. Physical hydrogels composed of polyampholytes demonstrate high toughness and viscoelasticity[J]. Nat Mater, 2013,12(10):932-937.
[20] Nonoyama T, Wada S, Kiyama R , et al. Double-network hydrogels strongly bondable to bones by spontaneous osteogenesis penetration[J]. Adv Mater, 2016,28(31):6740-6745.
[21] Haque MA, Kurokawa T, Gong JP . Super tough double network hydrogels and their application as biomaterials[J]. Polymer, 2012,53(9):1805-1822.
[22] Bellamy C, Shrestha S, Torneck C , et al. Effects of a bioactive scaffold containing a sustained transforming growth factor-β1-re-leasing nanoparticle system on the migration and differentiation of stem cells from the apical papilla[J]. J Endod, 2016,42(9):1385-1392.
[23] Galler KM, Cavender AC, Koeklue U , et al. Bioengineering of dental stem cells in a PE gylated fibrin gel[J]. Regen Med, 2011,6(2):191-200.
[24] Vining KH, Mooney DJ . Mechanical forces direct stem cell be-haviour in development and regeneration[J]. Nat Rev Mol Cell Bio, 2017,18(12):728-742.
[25] Caiazzo M, Okawa Y, Ranga A , et al. Defined three-dimensional microenvironments boost induction of pluripotency[J]. Nat Mater, 2016,15(3):344-352.
[26] Duval K, Grover H, Han L , et al. Modeling physiological events in 2D vs. 3D cell culture[J]. Physiology, 2017,32(4):266-277.
[27] Soares DG, Rosseto HL, Basso FG , et al. Chitosan-collagen biomembrane embedded with calcium-aluminate enhances dentinogenic potential of pulp cells[J]. Braz Oral Res, 2016,30(1):e54.
[28] Galler KM, D Souza RN, Hartgerink JD , et al. Scaffolds for dental pulp tissue engineering[J]. Adv Dent Res, 2011,23(3):333-339.
[29] Caliari SR, Burdick JA . A practical guide to hydrogels for cell culture[J]. Nat Methods, 2016,13(5):405-414.
[30] Boland T, Mironov V, Gutowska A , et al. Cell and organ printing 2: Fusion of cell aggregates in three-dimensional gels[J]. Anat Rec Part A, 2003,272A(2):497-502.
[31] Janmey PA, Miller RT . Mechanisms of mechanical signaling in development and disease[J]. J Cell Sci, 2011,124(1):9-18.
[32] Chen CS, Mrksich M, Huang S , et al. Geometric control of cell life and death[J]. Science, 1997,276(5317):1425-1428.
[1] Qianmin OU, Zhengshi LI, Luhan NIU, Qianhui REN, Xinyu LIU, Xueli MAO, Songtao SHI. Biological characteristics and translational research of dental stem cells [J]. Journal of Peking University (Health Sciences), 2025, 57(5): 827-835.
[2] Zhenlong LIU, Zhenchen HOU, Xiaoqing HU, Shuang REN, Qinwei GUO, Yan XU, Xi GONG, Yingfang AO. Arthroscopic tissue engineering scaffold repair for cartilage injuries [J]. Journal of Peking University (Health Sciences), 2025, 57(2): 384-387.
[3] Yibo HU, Weijia LYU, Wei XIA, Yihong LIU. Hydrodynamic finite element analysis of biological scaffolds with different pore sizes for cell growth and osteogenic differentiation [J]. Journal of Peking University (Health Sciences), 2025, 57(1): 97-105.
[4] Yu-ke LI,Mei WANG,Lin TANG,Yu-hua LIU,Xiao-ying CHEN. Effect of pH on the chelation between strontium ions and decellularized small intestinal submucosal sponge scaffolds [J]. Journal of Peking University (Health Sciences), 2023, 55(1): 44-51.
[5] Yi DENG,Yi ZHANG,Bo-wen LI,Mei WANG,Lin TANG,Yu-hua LIU. Effects of different crosslinking treatments on the properties of decellularized small intestinal submucosa porous scaffolds [J]. Journal of Peking University (Health Sciences), 2022, 54(3): 557-564.
[6] Qian-li ZHANG,Chong-yang YUAN,Li LIU,Shi-peng WEN,Xiao-yan WANG. Effects of electrospun collagen nanofibrous matrix on the biological behavior of human dental pulp cells [J]. Journal of Peking University(Health Sciences), 2019, 51(1): 28-34.
[7] Rong LI,Ke-long CHEN,Yong WANG,Yun-song LIU,Yong-sheng ZHOU,Yu-chun SUN. Establishment of a 3D printing system for bone tissue engineering scaffold fabrication and the evaluation of its controllability over macro and micro structure precision [J]. Journal of Peking University(Health Sciences), 2019, 51(1): 115-119.
[8] LIU Yan, FU Yu, LIU Shuai, ZHOU Yan-heng. Effects of microstructure of mineralized collagen scaffolds on cell morphology of MG 63 [J]. Journal of Peking University(Health Sciences), 2014, 46(1): 19-24.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!