Journal of Peking University (Health Sciences) ›› 2022, Vol. 54 ›› Issue (1): 31-39. doi: 10.19723/j.issn.1671-167X.2022.01.006

Previous Articles     Next Articles

Effect of porous zirconia ceramics on proliferation and differentiation of osteoblasts

WANG Zheng1,DING Qian1,2,(),GAO Yuan1,MA Quan-quan1,ZHANG Lei1,(),GE Xi-yuan3,SUN Yu-chun1,4,XIE Qiu-fei1   

  1. 1. Department of Prosthodontics, Peking University School and Hospital of Stomatology & National Center of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology & NHC Research Center of Engineering and Technology for Computerized Dentistry & NMPA Key Laboratory for Dental Materials, Beijing 100081, China
    2. Foshan (Southern China) Institute for New Materials, Foshan 528000, Guangdong, China
    3. Central Laboratory, Peking University School and Hospital of Stomatology, Beijing 100081, China
    4. Center for Digital Dentistry, Peking University School and Hospital of Stomatology, Beijing 100081, China
  • Received:2021-10-07 Online:2022-02-18 Published:2022-02-21
  • Contact: Qian DING,Lei ZHANG E-mail:dingqian.623@163.com;drzhanglei@yeah.net
  • Supported by:
    Capital Health Development Research Special Fund(2020-2-4104);Beijing Natural Science Foundation(7192233);Guangdong Basic and Applied Basic Research Foundation(2019A1515110889)

RICH HTML

  

Abstract:

Objective: To investigate the effect of porous surface morphology of zirconia on the proliferation and differentiation of osteoblasts. Methods: According to different manufacturing and pore-forming methods, the zirconia specimens were divided into 4 groups, including milled sintering group (M-Ctrl), milled porous group (M-Porous), 3D printed sintering group (3D-Ctrl) and 3D printed porous group (3D-Porous). The surface micromorphology, surface roughness, contact angle and surface elements of specimens in each group were detected by scanning electron microscope (SEM), 3D laser microscope, contact angle measuring device and energy-dispersion X-ray analysis, respectively. MC3T3-E1 cells were cultured on 4 groups of zirconia discs. The cell morphology of MC3T3-E1 cells on zirconia discs was eva-luated on 1 and 7 days by SEM. The cell proliferation was detected on 1, 3 and 5 days by cell counting kit-8 (CCK-8). After osteogenic induction for 14 days, the relative mRNA expression of alkaline phosphatase (ALP), type Ⅰ collagen (Colla1), Runt-related transcription factor-2 (Runx2) and osteocalcin (OCN) in MC3T3-E1 cells were detected by real-time quantitative polymerase chain reaction. Results: The pore size [(419.72±6.99) μm] and pore depth [(560.38±8.55) μm] of 3D-Porous group were significantly larger than the pore size [(300.55±155.65) μm] and pore depth [(69.97±31.38) μm] of M-Porous group (P<0.05). The surface of 3D-Porous group appeared with more regular round pores than that of M-Porous group. The contact angles of all the groups were less than 90°. The contact angles of 3D-Ctrl (73.83°±5.34°) and M-Porous group (72.7°±2.72°) were the largest, with no significant difference between them (P>0.05). Cells adhered inside the pores in M-Porous and 3D-Porous groups, and the proliferation activities of them were significantly higher than those of M-Ctrl and 3D-Ctrl groups after 3 and 5 days’ culture (P<0.05). After 14 days’ incubation, ALP, Colla1, Runx2 and OCN mRNA expression in 3D-Porous groups were significantly lower than those of M-Ctrl and 3D-Ctrl groups (P<0.05). Colla1, Runx2 and OCN mRNA expressions in M-Porous group were higher than those of 3D-Porous group (P<0.05). Conclusion: The porous surface morphology of zirconia can promote the proliferation and adhesion but inhibit the differentiation of MC3T3-E1 cells.

Key words: Zirconia, Porous surface, Osteoblasts, Osseointegration

CLC Number: 

  • R781.3

Figure 1

Zirconia disks M-Ctrl, milled sintering group; M-Porous, milled porous group; 3D-Ctrl, 3D printed sintering group; 3D-Porous, 3D printed porous group."

Table 1

Real-time PCR primer sequence"

Gene Forward primer (5'-3') Reverse primer (5'-3')
GAPDH TGGTGAAGGTCGGTGTGAAC GCTCCTGGAAGATGGTGATGG
ALP TGCCTACTTGTGTGGCGTGAA TCACCCGAGTGGTAGTCACAATG
Colla1 TGAAGAACTGGACTGTCCC TTTGGTGATACGTATTCTTCCG
Runx2 GACTGTGGTTACCGTCATGGC ACTTGGTTTTTCATAACAGCGGA
OCN CCAAGCAGGAGGGCAATAAGGT CTCGTCACAAGCAGGGTTAAGC

Table 2

Surface pore size of porous zirconia disks"

Items M-Porous 3D-Porous
Diameter of pores/μm, $\bar{x}\pm s$ 300.55±155.65 419.72±6.99*
Depth of pores/μm, $\bar{x}\pm s$ 69.97±31.38 560.38±8.55*
Pitch of pores/μm, $\bar{x}\pm s$ 349.87±12.43

Figure 2

Scanning electron microscope images of zirconia disks M-Ctrl, milled sintering group; M-Porous, milled porous group; 3D-Ctrl, 3D printed sintering group; 3D-Porous, 3D printed porous group."

Figure 3

Scanning electron microscope images of MC3T3-E1 cells on zirconia discs after incubation for 1 and 7 days M-Ctrl, milled sintering group; M-Porous, milled porous group; 3D-Ctrl, 3D printed sintering group; 3D-Porous, 3D printed porous group."

Figure 4

Cell proliferation of MC3T3-E1 cells after 1, 3 and 5 days M-Ctrl, milled sintering group; M-Porous, milled porous group; 3D-Ctrl, 3D printed sintering group; 3D-Porous, 3D printed porous group. Four groups comparison: 1 d, H=31.834, P < 0.001; 3 d, F=54.633, P < 0.001; 5 d, H=44.859, P < 0.001. *P<0.05, △P < 0.001."

Figure 5

Relative mRNA expression of ALP, Colla1, Runx2 and OCN in MC3T3-E1 cells Relative gene expression of osteogenic differentiation proteins ALP, Colla1, Runx2 and OCN in MC3T3-E1 cells. M-Ctrl, milled sintering group; M-Porous, milled porous group; 3D-Ctrl, 3D printed sintering group; 3D-Porous, 3D printed porous group. Four groups comparison: ALP, H=61.635, P<0.001; Colla1, H=49.518, P<0.001; Runx2, H=55.728, P<0.001; OCN, H=38.236, P<0.001. #P<0.01, △P < 0.001."

[1] Hanawa T. Zirconia versus titanium in dentistry: a review[J]. Dent Mater J, 2020, 39(1):24-36.
doi: 10.4012/dmj.2019-172 pmid: 31666488
[2] Yoshinari M. Future prospects of zirconia for oral implants: a review[J]. Dent Mater J, 2020, 39(1):37-45.
doi: 10.4012/dmj.2019-151 pmid: 31666487
[3] Roehling S, Astasov-Frauenhoffer M, Hauser-Gerspach I, et al. In vitro biofilm formation on titanium and zirconia implant surfaces[J]. J Periodontol, 2017, 88(3):298-307.
doi: 10.1902/jop.2016.160245 pmid: 27712464
[4] Hafezeqoran A, Koodaryan R. Effect of zirconia dental implant surfaces on bone integration: a systematic review and meta analysis[J]. Biomed Res Int, 2017, 2017:9246721.
doi: 10.1155/2017/9246721 pmid: 28299337
[5] Cionca N, Hashim D, Mombelli A. Zirconia dental implants: where are we now, and where are we heading?[J]. Periodontol 2000, 2017, 73(1):241-258.
doi: 10.1111/prd.12180
[6] Adanez MH, Nishihara H, Att W. A systematic review and meta analysis on the clinical outcome of zirconia implant restoration complex[J]. J Prosthodont Res, 2018, 62(4):397-406.
doi: 10.1016/j.jpor.2018.04.007
[7] Roehling S, Schlegel KA, Woelfler H, et al. Zirconia compared to titanium dental implants in preclinical studies: a systematic review and meta analysis[J]. Clin Oral Implants Res, 2019, 30(5):365-395.
[8] Kohal RJ, Bachle M, Att W, et al. Osteoblast and bone tissue response to surface modified zirconia and titanium implant materials[J]. Dent Mater, 2013, 29(7):763-776.
doi: 10.1016/j.dental.2013.04.003 pmid: 23669198
[9] El-Hadad S, Safwat EM, Sharaf NF. In vitro and in vivo, cytoto-xicity evaluation of cast functionally graded biomaterials for dental implantology[J]. Mater Sci Eng C Mater Biol Appl, 2018, 93:987-995.
doi: 10.1016/j.msec.2018.09.003
[10] Shirazi HA, Ayatollahi MR, Asnafi A. To reduce the maximum stress and the stress shielding effect around a dental implant bone interface using radial functionally graded biomaterials[J]. Comput Methods Biomech Biomed Engin, 2017, 20(7):750-759.
doi: 10.1080/10255842.2017.1299142
[11] Dele-Afolabi TT, Hanim MAA, Norkhairunnisa M, et al. Research trend in the development of macroporous ceramic components by pore forming additives from natural organic matters: a short review[J]. Ceram Int, 2017, 43(2):1633-1649.
doi: 10.1016/j.ceramint.2016.10.177
[12] Hadjicharalambous C, Mygdali E, Prymak O, et al. Proliferation and osteogenic response of MC3T3-E1 preosteoblastic cells on porous zirconia ceramics stabilized with magnesia or yttria[J]. J Biomed Mater Res A, 2015, 103(11):3612-3624.
doi: 10.1002/jbm.a.35475 pmid: 25847599
[13] Prymak O, Vagiaki LE, Buyakov A, et al. Porous zirconia/magnesia ceramics support osteogenic potential in vitro[J]. Materials (Basel), 2021, 14(4):1049.
doi: 10.3390/ma14041049
[14] 王艳芬, 牛光良, 韩建民. 氧化锆微米涂层对成骨细胞增殖和分化的影响[J]. 中华口腔医学杂志, 2018, 53(5):339-343.
[15] Ali N, Safwat A, Aboushelib M. The effect of fusion sputtering surface treatment on microshear bond strength of zirconia and MDP containing resin cement[J]. Dent Mater, 2019, 35(6):107-112.
[16] Liu Y, Rath B, Tingart M, et al. Role of implants surface modification in osseointegration: a systematic review[J]. J Biomed Mater Res A, 2020, 108(3):470-484.
doi: 10.1002/jbm.a.36829 pmid: 31664764
[17] Sakthiabirami K, Kang JH, Jang JG, et al. Hybrid porous zirconia scaffolds fabricated using additive manufacturing for bone tissue engineering applications[J]. Mater Sci Eng C Mater Biol Appl, 2021, 123:111950.
doi: 10.1016/j.msec.2021.111950
[18] Hwa LC, Rajoo S, Noor AM, et al. Recent advances in 3D prin-ting of porous ceramics: a review[J]. Curr Opin Solid State Mater Sci, 2017, 21(6):323-347.
doi: 10.1016/j.cossms.2017.08.002
[19] Li R, Chen H, Wang Y, et al. Performance of stereolithography and milling in fabricating monolithic zirconia crowns with different finish line designs[J]. J Mech Behav Biomed Mater, 2021, 115:104255.
doi: 10.1016/j.jmbbm.2020.104255
[20] Chen ZW, Li ZY, Li JJ, et al. 3D printing of ceramics: a review[J]. J Eur Ceram Soc, 2019, 39(4):661-687.
doi: 10.1016/j.jeurceramsoc.2018.11.013
[21] Zaharin HA, Rani AMA, Azam FI, et al. Effect of unit cell type and pore size on porosity and mechanical behavior of additively manufactured Ti6Al4V scaffolds[J]. Materials (Basel), 2018, 11(12):2402.
doi: 10.3390/ma11122402
[22] Arabnejad S, Johnston RB, Pura JA, et al. High-strength porous biomaterials for bone replacement: a strategy to assess the interplay between cell morphology, mechanical properties, bone ingrowth and manufacturing constraints[J]. Acta Biomater, 2016, 30:345-356.
doi: S1742-7061(15)30177-X pmid: 26523335
[23] Bael SV, Chai YC, Truscello S, et al. The effect of pore geometry on the in vitro biological behavior of human periosteum derived cells seeded on selective laser melted Ti6Al4V bone scaffolds[J]. Acta Biomater, 2012, 8(7):2824-2834.
doi: 10.1016/j.actbio.2012.04.001 pmid: 22487930
[24] Wang XJ, Xu SQ, Zhou SW, et al. Topological design and additive manufacturing of porous metals for bone scaffolds and orthopaedic implants: a review[J]. Biomaterials, 2016, 83:127-141.
doi: 10.1016/j.biomaterials.2016.01.012
[25] Hadjicharalambous C, Buyakov A, Buyakova S, et al. Porous alumina, zirconia and alumina/zirconia for bone repair: fabrication, mechanical and in vitro biological response[J]. Biomed Mater, 2015, 10(2):025012.
doi: 10.1088/1748-6041/10/2/025012
[26] Wang H, Su KX, Su LZ, et al. The effect of 3D-printed Ti6Al4V scaffolds with various macropore structures on osteointegration and osteogenesis: a biomechanical evaluation[J]. J Mech Behav Biomed Mater, 2018, 88:488-496.
doi: S1751-6161(18)30687-8 pmid: 30223212
[27] 赖颖真, 卢薛冠, 蔡艺煌. 钛及氧化锆表面微沟槽结构对人牙龈成纤维细胞生物学行为的影响[J]. 中华口腔医学杂志, 2019, 54(10):676-682.
[28] Wang C, Xu DL, Li SJ, et al. Effect of pore size on the physicochemical properties and osteogenesis of Ti6Al4V porous scaffolds with bionic structure[J]. ACS Omega, 2020, 5(44):28684-28692.
doi: 10.1021/acsomega.0c03824
[29] Kapat K, Srivas PK, Rameshbabu AP, et al. Influence of porosity and pore size distribution in Ti6Al4V foam on physicomechanical properties, osteogenesis, and quantitative validation of bone ingrowth by micro computed tomography[J]. ACS Appl Mater Interfaces, 2017, 9(45):39235-39248.
doi: 10.1021/acsami.7b13960
[30] Gitten RA, McLachlan T, Olivares-Navarrete R, et al. The effects of combined micron/submicron scale surface roughness and nanoscale features on cell proliferation and differentiation[J]. Biomaterials, 2011, 32(13):3395-3403.
doi: 10.1016/j.biomaterials.2011.01.029
[31] Wang XK, Schwartz Z, Gittens RA, et al. Role of integrin alpha2 beta1 in mediating osteoblastic differentiation on three dimensional titanium scaffolds with submicron scale texture[J]. J Biomed Mater Res A, 2015, 103(6):1907-1918.
doi: 10.1002/jbm.a.v103.6
[32] Lv J, Jia ZJ, Li J, et al. Electron beam melting fabrication of porous Ti6Al4V scaffolds: cytocompatibility and osteogenesis[J]. Adv Eng Mater, 2015, 17(9):1391-1398.
doi: 10.1002/adem.v17.9
[33] Rezaei NM, Hasegawa M, Ishijima M, et al. Biological and osseointegration capabilities of hierarchically (meso/micro/nano scale) roughened zirconia[J]. Int J Nanomedicine, 2018, 13:3381-3395.
doi: 10.2147/IJN
[34] Mostafa D, Aboushelib M. Bioactive-hybrid-zirconia implant surface for enhancing osseointegration: an in vivo study[J]. Int J Implant Dent, 2018, 4(1):20.
doi: 10.1186/s40729-018-0129-3 pmid: 29900480
[35] Xing HY, Zou B, Li SS, et al. Study on surface quality, precision and mechanical properties of 3D printed ZrO2 ceramic components by laser scanning stereolithography[J]. Ceram Int, 2017, 43(18):16340-16347.
doi: 10.1016/j.ceramint.2017.09.007
[36] Zhu YL, Zhu RQ, Ma J, et al. In vitro cell proliferation evaluation of porous nano zirconia scaffolds with different porosity for bone tissue engineering[J]. Biomed Mater, 2015, 10(5):055009.
doi: 10.1088/1748-6041/10/5/055009
[37] Seuba J, Deville S, Guizard C, et al. The effect of wall thickness distribution on mechanical reliability and strength in unidirectional porous ceramics[J]. Sci Technol Adv Mater, 2016, 17(1):128-135.
doi: 10.1080/14686996.2016.1140309
[1] Jianxiao ZHAO, Qian DING, Wenjin LI, Quanquan MA, Yixiao LAN, Lei ZHANG, Jianmin HAN. Effect of porous surface structure on fatigue strength of 3D printed zirconia [J]. Journal of Peking University (Health Sciences), 2025, 57(6): 1165-1173.
[2] Kun QIAN, Yihong LIU. Fitness of onlays fabricated with direct and indirect CAD/CAM technology in vitro [J]. Journal of Peking University (Health Sciences), 2025, 57(3): 604-609.
[3] Qian DING,Wen-jin LI,Feng-bo SUN,Jing-hua GU,Yuan-hua LIN,Lei ZHANG. Effects of surface treatment on the phase and fracture strength of yttria- and magnesia-stabilized zirconia implants [J]. Journal of Peking University (Health Sciences), 2023, 55(4): 721-728.
[4] Wei-wei LI,Hu CHEN,Yong WANG,Yu-chun SUN. Research on friction and wear behaviors of silicon-lithium spray coating on zirconia ceramics [J]. Journal of Peking University (Health Sciences), 2023, 55(1): 94-100.
[5] LI Wen-jin,DING Qian,YUAN Fu-song,Sun Feng-bo,ZHENG Jian-qiao,BAO Rui,Zhang Lei. Effects of femtosecond laser treatment on surface characteristics and flexural strength of zirconia [J]. Journal of Peking University (Health Sciences), 2021, 53(4): 770-775.
[6] WANG Li-xin , XU Xiao, NI Yao-feng, SUN Hai-tao, YU Ri-yue, WEI Shi-cheng. In vivo study of liposome-modified polyetheretherketone implant on bacteriostasis and osseointegration [J]. Journal of Peking University (Health Sciences), 2021, 53(4): 758-763.
[7] YANG Xin,LI Rong,YE Hong-qiang,CHEN Hu,WANG Yong,ZHOU Yong-sheng,SUN Yu-chun. Evaluation of fracture strength of two kinds of zirconia all-ceramic crowns with different edge compensation angles [J]. Journal of Peking University (Health Sciences), 2021, 53(2): 402-405.
[8] LI Zheng,WANG Xiao,HONG Tian-pei,WANG Hao-jie,GAO Zhan-yi,WAN Meng. Mechanism of advanced glycation end products inhibiting the proliferation of peripheral blood mononuclear cells and osteoblasts in rats [J]. Journal of Peking University (Health Sciences), 2021, 53(2): 355-363.
[9] Miao ZHENG,Ling-lu ZHAN,Zhi-qiang LIU,He-ping LI,Jian-guo TAN. Effect of different plasma treated zirconia on the adhensive behaviour of human gingival fibroblasts [J]. Journal of Peking University(Health Sciences), 2019, 51(2): 315-320.
[10] Zhi-yong△ ZHANG,Tian MENG,Quan CHEN,Wen-shu LIU,Yu-huan CHEN. Retrospective analysis of early dental implant failure [J]. Journal of Peking University(Health Sciences), 2018, 50(6): 1088-1091.
[11] ZHOU Tuan-feng, WANG Xin-zhi . Clinical observation of the restoration of computer aided designed and manufactured one-piece zirconia posts and cores: a 5-year prospective follow-up study [J]. Journal of Peking University(Health Sciences), 2018, 50(4): 680-684.
[12] GAN Hong-quan, WANG Qian, ZHANG Hui, LIU Xin, DENG Hua-min, SONG Hui-ping, WANG ZHi-qiang, LI Qi-jia. Effects of RGD peptides-grafted porous tantalum on morphological change of MG63 osteoblasts-tantalum conjunctive interface and expression of osteogenesis factors [J]. Journal of Peking University(Health Sciences), 2018, 50(1): 176-182.
[13] CUI Xin-yue, TONG Dai, WANG Xin-zhi, SHEN Zhi-jian. Comparison of the translucency and color masking effect of the zirconia ceramics made by milling and gel deposition [J]. Journal of Peking University(Health Sciences), 2018, 50(1): 85-90.
[14] LIAO Yu, LIU Xiao-qiang, CHEN Li, ZHOU Jian-feng, TAN Jian-guo. Effects of different surface treatments on the zirconia-resin cement bond strength [J]. Journal of Peking University(Health Sciences), 2018, 50(1): 53-57.
[15] JIAO Yang, WANG Ji-de, DENG Jiu-peng. Effect of different surface treatments on the crystal structure and properties of zirconia [J]. Journal of Peking University(Health Sciences), 2018, 50(1): 49-52.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!