Email Alert | RSS

Journal of Peking University (Health Sciences) ›› 2024, Vol. 56 ›› Issue (1): 9-16. doi: 10.19723/j.issn.1671-167X.2024.01.003

Previous Articles     Next Articles

Ubiquitin-specific protease 42 regulates osteogenic differentiation of human adipose-derived stem cells

Yuan PAN1,Hang GU1,Han XIAO1,Lijun ZHAO1,Yiman TANG2,*(),Wenshu GE1,*()   

  1. 1. Department of General Dentistry Ⅱ, Peking University School and Hospital of Stomatology & National Center for Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Research Center of Oral Biomate-rials and Digital Medical Devices, Beijing 100081, China
    2. Fourth Clinical Division, Peking University School and Hospital of Stomatology, Beijing 100025, China
  • Received:2023-10-08 Online:2024-02-18 Published:2024-02-06
  • Contact: Yiman TANG,Wenshu GE E-mail:yimantang@bjmu.edu.cn;wenshuge@bjmu.edu.cn
  • Supported by:
    National Natural Science Foundation of China(82071089);National Natural Science Foundation of China(82001013)

RICH HTML

   

PDF (PC)

Abstract:

Objective: To explore the effect of ubiquitin-specific protease 42 (USP42) on osteogenic differentiation of human adipose-derived stem cells (hASCs) in vivo and in vitro. Methods: A combination of experiments was carried out with genetic depletion of USP42 using a lentiviral strategy. Alkaline phosphatase (ALP) staining and quantification, alizarin red S (ARS) staining and quantification were used to determine the osteogenic differentiation ability of hASCs under osteogenic induction between the experimental group (knockdown group and overexpression group) and the control group. Quantitative reverse transcription PCR (qRT-PCR) was used to detect the expression levels of osteogenesis related genes in the experimental group and control group, and Western blotting was used to detect the expression levels of osteogenesis related proteins in the experimental group and control group. Nude mice ectopic implantation experiment was used to evaluate the effect of USP42 on the osteogenic differentiation of hASCs in vivo. Results: The mRNA and protein expressions of USP42 in knockdown group were significantly lower than those in control group, and those in overexpression group were significantly higher than those in control group. After 7 days of osteogenic induction, the ALP activity in the knockdown group was significantly higher than that in the control group, and ALP activity in overexpression group was significantly lower than that in control group. After 14 days of osteogenic induction, ARS staining was significantly deeper in the knockdown group than in the control group, and significantly lighter in overexpression group than in the control group. The results of qRT-PCR showed that the mRNA expression levels of ALP, osterix (OSX) and collagen type Ⅰ (COLⅠ) in the knockdown group were significantly higher than those in the control group after 14 days of osteogenic induction, and those in overexpression group were significantly lower than those in control group. The results of Western blotting showed that the expression levels of runt-related transcription factor 2 (RUNX2), OSX and COLⅠ in the knockout group were significantly higher than those in the control group at 14 days after osteogenic induction, while the expression levels of RUNX2, OSX and COLⅠ in the overexpression group were significantly lower than those in the control group. Hematoxylin-eosin staining of subcutaneous grafts in nude mice showed that the percentage of osteoid area in the knockdown group was significantly higher than that in the control group. Conclusion: Knockdown of USP42 can significantly promote the osteogenic differentiation of hASCs in vitro and in vivo, and overexpression of USP42 significantly inhibits in vivo osteogenic differentiation of hASCs, and USP42 can provide a potential therapeutic target for bone tissue engineering.

Key words: Ubiquitin-specific proteases, Human adipose-derived stem cells, Cell differentiation, Bone and bones, Regenerative medicine

CLC Number: 

  • R318

Table 1

Sequences of experimentally relevant qRT-PCR primers"

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
USP42 AATCTTCAGACCCATCAGCCT AGAACCTGCATCCATGTCTCC
ALP ATGGGATGGGTGTCTCCACA CCACGAAGGGGAACTTGTC
OSX CCTCTGCGGGACTCAACAAC TAAAGGGGGCTGGATAAGCAT
COLⅠ TGGTCCCAAGGGTAACAGCG AACACCAACAGGGCCAGGCT

Figure 1

Expression of green fluorescent protein in hASCs after 72 h transfection with lentivirus in knockdown group (shUSP42-1, shUSP42-2) and control group (shNC) shNC, short hairpin RNA normal control; shUSP42, short hairpin RNA ubiquitin-specific protease 42; hASCs, human adipose-derived stem cells."

Figure 2

Expression of green fluorescent protein in hASCs after 72 h transfection with lentivirus in overexpression group (WT-USP42) and control group (Vector) WT-USP42, wildtype ubiquitin-specific protease 42; hASCs, human adipose-derived stem cells."

Figure 3

Detection of knockdown efficiency of USP42 by qRT-PCR and Western blotting USP42, ubiquitin-specific protease 42; shNC, short hairpin RNA normal control; shUSP42, short hairpin RNA USP42; GAP, glyceraldehyde-3-phosphate; qRT-PCR, quantitative reverse transcription PCR."

Figure 4

Detection of overexpression efficiency of USP42 by qRT-PCR and Western blotting USP42, ubiquitin-specific protease 42; WT-USP42, wildtype USP42; GAP, glyceraldehyde-3-phosphate; qRT-PCR, quantitative reverse transcription PCR."

Figure 5

ALP staining and quantification of activity at 7 days of osteogenic induction after USP42 knockdown by hASCs shNC, short hairpin RNA normal control; USP42, ubiquitin-specific protease 42; shUSP42, short hairpin RNA USP42; PM, proliferation medium; OM, osteogenic medium; ALP, alkaline phosphatase; hASCs, human adipose-derived stem cells."

Figure 6

ARS staining and quantification at 14 days of osteogenic induction after USP42 knockdown by hASCs shNC, short hairpin RNA normal control; USP42, ubiquitin-specific protease 42; shUSP42, short hairpin RNA USP42; PM, proliferation medium; OM, osteogenic medium; ARS, alizarin red S; hASCs, human adipose-derived stem cells."

Figure 7

mRNA expression levels of ALP, OSX, and COLⅠ at 14 days of osteogenic induction after USP42 knockdown by hASCs PM, proliferation medium; OM, osteogenic medium; shNC, short hairpin RNA normal control; USP42, ubiquitin-specific protease 42; shUSP42, short hairpin RNA USP42; ALP, alkaline phosphatase; OSX, osterix; COLⅠ, collagen type Ⅰ; hASCs, human adipose-derived stem cells."

Figure 8

Protein expression levels of RUNX2, OSX, and COLⅠ at 14 days of osteogenic induction after USP42 knockdown by hASCs shNC, short hairpin RNA normal control; USP42, ubiquitin-specific protease 42; shUSP42, short hairpin RNA USP42; RUNX2, runt-related transcription factor 2; GAP, glyceraldehyde-3-phosphate; COLⅠ, collagen type Ⅰ; OSX, osterix; hASCs, human adipose-derived stem cells."

Figure 9

ALP staining and quantification of activity at 7 d of osteogenic induction after hASCs overexpression of USP42 USP42, ubiquitin-specific protease 42; WT-USP42, wildtype USP42; PM, proliferation medium; OM, osteogenic medium; ALP, alkaline phosphatase; hASCs, human adipose-derived stem cells."

Figure 10

ARS staining and quantification at 14 d of osteogenic induction after hASCs overexpression of USP42 USP42, ubiquitin-specific protease 42; WT-USP42, wildtype USP42; PM, proliferation medium; OM, osteogenic medium; ARS, alizarin red S; hASCs, human adipose-derived stem cells."

Figure 11

mRNA expression levels of ALP, OSX, and COLⅠ at 14 d of osteogenic induction after hASCs overexpression of USP42 USP42, ubiquitin-specific protease 42; WT-USP42, wildtype USP42; PM, proliferation medium; OM, osteogenic medium; ALP, alkaline phosphatase; OSX, osterix; COLⅠ, collagen type Ⅰ; hASCs, human adipose-derived stem cells."

Figure 12

Protein expression levels of RUNX2, OSX, and COLⅠ at 14 d of osteogenic induction after hASCs overexpression of USP42 USP42, ubiquitin-specific protease 42; WT-USP42, wildtype USP42; RUNX2, runt-related transcription factor 2; GAP, glyceraldehyde-3-phosphate; COLⅠ, collagen type Ⅰ; OSX, osterix; hASCs, human adipose-derived stem cells."

Figure 13

Hematoxylin-eosin staining (×200) and bone morphometrics analysis shNC, short hairpin RNA normal control; shUSP42, short hairpin RNA ubiquitin-specific protease 42."

1 Lin H , Sohn J , Shen H , et al. Bone marrow mesenchymal stem cells: Aging and tissue engineering applications to enhance bone healing[J]. Biomaterials, 2019, 203, 96- 110.
doi: 10.1016/j.biomaterials.2018.06.026
2 Bunpetch V , Zhang Z Y , Zhang X , et al. Strategies for MSC expansion and MSC-based microtissue for bone regeneration[J]. Biomaterials, 2019, 196, 67- 79.
doi: 10.1016/j.biomaterials.2017.11.023
3 刘云松, 周永胜, 葛雯姝, 等. 原代人脂肪基质细胞体内成骨能力的检测[J]. 北京大学学报(医学版), 2012, 44 (1): 55- 58.
doi: 10.3969/j.issn.1671-167X.2012.01.012
4 周永胜, 刘云松, 葛雯姝, 等. 人脂肪基质细胞在骨组织工程学中的应用[J]. 北京大学学报(医学版), 2012, 44 (1): 160- 162.
5 Snyder NA , Silva GM . Deubiquitinating enzymes (DUBs): Regulation, homeostasis, and oxidative stress response[J]. J Biol Chem, 2021, 297 (3): 101077.
doi: 10.1016/j.jbc.2021.101077
6 Ge F , Li Y , Yuan T , et al. Deubiquitinating enzymes: Promising targets for drug resistance[J]. Drug Discov Today, 2022, 27 (9): 2603- 2613.
doi: 10.1016/j.drudis.2022.06.009
7 Wang X . Stem cells in tissues, organoids, and cancers[J]. Cell Mol Life Sci, 2019, 76 (20): 4043- 4070.
doi: 10.1007/s00018-019-03199-x
8 Guo YC , Zhang SW , Yuan Q . Deubiquitinating enzymes and bone remodeling[J]. Stem Cells Int, 2018, 2018, 3712083.
9 Suresh B , Lee J , Kim H , et al. Regulation of pluripotency and differentiation by deubiquitinating enzymes[J]. Cell Death Differ, 2016, 23 (8): 1257- 1264.
doi: 10.1038/cdd.2016.53
10 Tang YM , Lv LW , Li WY , et al. Protein deubiquitinase USP7 is required for osteogenic differentiation of human adipose-derived stem cells[J]. Stem Cell Res Ther, 2017, 8 (1): 186.
doi: 10.1186/s13287-017-0637-8
11 Hock AK , Vigneron AM , Vousden KH . Ubiquitin-specific peptidase 42 (USP42) functions to deubiquitylate histones and regulate transcriptional activity[J]. J Biol Chem, 2014, 289 (50): 34862- 34870.
doi: 10.1074/jbc.M114.589267
12 Hock AK , Vigneron AM , Carter S , et al. Regulation of p53 stability and function by the deubiquitinating enzyme USP42[J]. EMBO J, 2011, 30 (24): 4921- 4930.
doi: 10.1038/emboj.2011.419
13 Giebel N , De Jaime-Soguero A , Garcia Del Arco A , et al. USP42 protects ZNRF3/RNF43 from R-spondin-dependent clearance and inhibits Wnt signalling[J]. EMBO Rep, 2021, 22 (5): e51415.
doi: 10.15252/embr.202051415
14 Orkin SH , Hochedlinger K . Chromatin connections to pluripotency and cellular reprogramming[J]. Cell, 2011, 145 (6): 835- 850.
doi: 10.1016/j.cell.2011.05.019
15 Atlasi Y , Stunnenberg HG . The interplay of epigenetic marks during stem cell differentiation and development[J]. Nat Rev Genet, 2017, 18 (11): 643- 658.
doi: 10.1038/nrg.2017.57
16 Reyes-Thrcu FE , Wilkinson KD . Polyubiquitin binding and dis-assembly by deubiquitinating enzymes[J]. Chem Rev, 2009, 109 (4): 1495- 1508.
doi: 10.1021/cr800470j
17 Frezza M , Schmitt S , Dou QP . Targeting the ubiquitin-proteasome pathway: An emerging concept in cancer therapy[J]. Curr Top Med Chem, 2011, 11 (23): 2888- 2905.
doi: 10.2174/156802611798281311
18 Das T , Shin SC , Song EJ , et al. Regulation of deubiquitinating enzymes by post-translational modifications[J]. Int J Mol Sci, 2020, 21 (11): 4028.
doi: 10.3390/ijms21114028
19 Sun X , Xie Z , Ma Y , et al. TGF-beta inhibits osteogenesis by upregulating the expression of ubiquitin ligase SMURF1 via MAPK-ERK signaling[J]. J Cell Physiol, 2018, 233 (1): 596- 606.
doi: 10.1002/jcp.25920
20 Rahman MS , Akhtar N , Jamil HM , et al. TGF-beta/BMP signaling and other molecular events: Regulation of osteoblastogenesis and bone formation[J]. Bone Res, 2015, 3, 15005.
doi: 10.1038/boneres.2015.5
21 Fan Y , Hanai JI , Le PT , et al. Parathyroid hormone directs bone marrow mesenchymal cell fate[J]. Cell Metab, 2017, 25 (3): 661- 672.
doi: 10.1016/j.cmet.2017.01.001
22 Lim KE , Park NR , Che X , et al. Core binding factor beta of osteoblasts maintains cortical bone mass via stabilization of Runx2 in mice[J]. J Bone Miner Res, 2015, 30 (4): 715- 722.
doi: 10.1002/jbmr.2397
23 Mishra R , Kumawat KL , Basu A , et al. Japanese encephalitis virus infection increases USP42 to stabilize TRIM21 and OAS1 for neuroinflammatory and anti-viral response in human microglia[J]. Virology, 2022, 573, 131- 140.
doi: 10.1016/j.virol.2022.06.012
24 Matsui M , Sakasai R , Abe M , et al. USP42 enhances homologous recombination repair by promoting R-loop resolution with a DNA-RNA helicase DHX9[J]. Oncogenesis, 2020, 9 (6): 60.
doi: 10.1038/s41389-020-00244-4
25 Liu S , Wang T , Shi Y , et al. USP42 drives nuclear speckle mRNA splicing via directing dynamic phase separation to promote tumorigenesis[J]. Cell Death Differ, 2021, 28 (8): 2482- 2498.
doi: 10.1038/s41418-021-00763-6
[1] Yuanzhi JIAN,Fei WANG,Ning YIN,Ruoyu ZHOU,Junbo WANG. Developmental toxicity of Cry1Ab protein in the embryonic stem-cell model [J]. Journal of Peking University (Health Sciences), 2024, 56(2): 213-222.
[2] Xiaoying CHEN,Yi ZHANG,Yuke LI,Lin TANG,Yuhua LIU. Effects of different polymers on biomimetic mineralization of small intestine submucosal scaffolds [J]. Journal of Peking University (Health Sciences), 2024, 56(1): 17-24.
[3] LAN Lin,HE Yang,AN Jin-gang,ZHANG Yi. Relationship between prognosis and different surgical treatments of zygomatic defects: A retrospective study [J]. Journal of Peking University (Health Sciences), 2022, 54(2): 356-362.
[4] ZHAO Jian-fang,LI Dong,AN Yang. Roles of ten eleven translocation proteins family and 5-hydroxymethylcytosine in epigenetic regulation of stem cells and regenerative medicine [J]. Journal of Peking University (Health Sciences), 2021, 53(2): 420-424.
[5] ZHANG Sheng-nan,AN Na,OUYANG Xiang-ying,LIU Ying-jun,WANG Xue-kui. Role of growth arrest-specific protein 6 in migration and osteogenic differentiation of human periodontal ligament cells [J]. Journal of Peking University (Health Sciences), 2021, 53(1): 9-15.
[6] SUI Hua-xin, LV Pei-jun, WANG Yong, FENG Yu-chi. Effects of low level laser irradiation on the osteogenic capacity of sodium alginate/gelatin/human adipose-derived stem cells 3D bio-printing construct [J]. Journal of Peking University(Health Sciences), 2018, 50(5): 868-875.
[7] SUI Hua-xin, LV Pei-jun, WANG Yu-guang, WANG Yong, SUN Yu-chun. Effect of lowlevel laser irradiation on proliferation and osteogenic differentiation of human adipose-derived stromal cells [J]. Journal of Peking University(Health Sciences), 2017, 49(2): 337-343.
[8] . A novel tissue-engineered bone constructed by using human adipose-derived #br# stem cells and biomimetic calcium phosphate scaffold coprecipitated with #br# bone morphogenetic protein-2 [J]. Journal of Peking University(Health Sciences), 2017, 49(1): 6-015.
[9] LING Long, ZHAO Yu-ming, GE Li-hong. Impact of different degree pulpitis on cell proliferation and osteoblastic differentiation of dental pulp stem cell in Beagle immature premolars [J]. Journal of Peking University(Health Sciences), 2016, 48(5): 878-883.
[10] GE Wen-shu, TANG Yi-man, ZHANG Xiao, LIU Yun-song, ZHOU Yong-sheng. Establishing a luciferase reporter system to evaluate osteogenic differentiation potential of human adipose-derived stem cells [J]. Journal of Peking University(Health Sciences), 2016, 48(1): 170-174.
[11] ZHANG Xiao, LIU Yun-song, LV Long-wei, CHEN Tong, WU Gang, ZHOU Yong-sheng. Promoted role of bone morphogenetic protein 2/7 heterodimer in the osteogenic differentiation of human adipose-derived stem cells [J]. Journal of Peking University(Health Sciences), 2016, 48(1): 37-44.
[12] YU Guang-yan, CAO Tong, ZOU Xiao-hui, ZHANG Xue-hui，FU Xin, PENG Shuang-qing, DENG Xu-liang, LI Sheng-lin, LIU He, XIAO Ran, OUYANG Hong-wei, PENG Hui, CHEN Xiao, ZHAO Zeng-ming, WANG Xiao-ying……. Development of human embryonic stem cell platforms for human health-safety #br# evaluation [J]. Journal of Peking University(Health Sciences), 2016, 48(1): 1-4.
[13] WANG Xiao-fei, LV Pei-jun, SONG Yang, WANG Yong, SUN Yu-chun. Short-term effect of CaCl2 on human adipose-derived mesenchymal stem cells proliferation and osteogenic differentiation [J]. Journal of Peking University(Health Sciences), 2015, 47(6): 971-976.
[14] JIA Shuang-shuang, LI Wei-yang, LIU Xin, LI Li-ying. Transforming growth factor-β1 induces differentiation of bone marrowderived mesenchymal stem cells into myofibroblasts via production of reactive oxygen species [J]. Journal of Peking University(Health Sciences), 2015, 47(5): 737-742.
[15] SONG Yi-Meng, MA Lu-Lin, LI Xiao-Xia, ZHU Yi. Mechanisms of prostaglandin E2-induced bone marrow-derived progenitor cell differentiation [J]. Journal of Peking University(Health Sciences), 2015, 47(4): 577-581.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Copyright © Journal of Peking University (Health Sciences), All Rights Reserved.
Powered by Beijing Magtech Co. Ltd