Journal of Peking University (Health Sciences) ›› 2020, Vol. 52 ›› Issue (4): 743-749. doi: 10.19723/j.issn.1671-167X.2020.04.028

Previous Articles     Next Articles

Effect of Porphyromonas gingivalis infection on atherosclerosis in apolipoprotein-E knockout mice

Yan XUAN1,Yu CAI2,Xiao-xuan WANG2,Qiao SHI2,Li-xin QIU1,(),Qing-xian LUAN2,()   

  1. 1. Fourth Clinical Division, Peking University School and Hospital of Stomatology, Beijing 100081, China
    2. Department of Periodontology, Peking University School and Hospital of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology & Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
  • Received:2018-10-11 Online:2020-08-18 Published:2020-08-06
  • Contact: Li-xin QIU,Qing-xian LUAN E-mail:qiulixin@263.com;kqluanqx@126.com
  • Supported by:
    National Natural Science Foundation of China(81271148);National Natural Science Foundation of China(8140030482)

RICH HTML

  

Abstract:

Objective: Studies have indicated that periodontal pathogen Porphyromonas gingivalis (P. gingivalis) infection may contributed to accelerate the development of atherosclerosis. The aim of this study was to investigate the effect of inflammation, oxidative stress and the mechanism on atherosclerosis in apolipoprotein-E knockout (ApoE-/-) mice with P. gingivalis infection. Methods: Eight-week-old male ApoE-/- mice (C57BL/6) were maintained under specific pathogen-free conditions and fed regular chow and sterile water after 1 weeks of housing. The animals were randomly divided into two groups: (a) ApoE-/- + PBS (n=8); (b) ApoE-/- + P.gingivalis strain FDC381 (n=8). Both of the groups received intravenous injections 3 times per week for 4 weeks since 8 weeks of age. The sham control group received injections with phosphate buffered saline only, while the P. gingivalis-challenged group with P.gingivalis strain FDC381at the same time. After 4 weeks, oxidative stress mediators and inflammation cytokines were analyzed by oil red O in heart, Enzyme linked immunosorbent assay (ELISA) in serum, quantitative real-time PCR and Western blot in aorta. Results: In our study, we found accelerated development of atherosclerosis and plaque formation in aorta with oil red O staining, increased oxidative stress markers [8-hydroxy-2-deoxyguanosine (8-OHdG), NADPH oxidase (NOX)-2 and NOX-4], as well as increased inflammation cytokines [interleukin (IL)-1β, IL-6 and tumor necrosis factor-α (TNF-α)] in the serum and aorta of the P. gingivalis-infected ApoE-/- mice. Compared with the control group, there was a significant increase protein level of nuclear factor-kappa B (NF-κB) in aorta after P. gingivalis infection. Conclusion: Our results suggest that chronic intravenous infection of P. gingivalis in ApoE-/- mice could accelerate the development of atherosclerosis by disturbing the lipid profile and inducing oxidative stress and inflammation. The NF-κB signaling pathway might play a potential role in the P. gingivalis-accelerated atherogenesis.

Key words: Porphyromonas gingivalis, Atherosclerosis, Inflammation, Oxidative stress, NF-κB signaling pathway

CLC Number: 

  • R781.42

Table 1

Primers used for quantitative real-time PCR"

Primer Forward(5'-3') Reverse(3'-5')
IL-1β CTATACCTGTCCTGTGTAATGAAAGA TCTGCTTGTGAGGTGCTGATGTA
IL-6 TAGCTACCTGGAGTACATGAAGAACA TGGTCCTTAGCCACTCCTTCTG
TNF-α AGGCGGTGCCTATGTCTCAG GCCATTTGGGAACTTCTCATC
NOX-2 GCCCAAAGGTGTCCAAGC TCCCCAACGATGCGGATAT
NOX-4 ACCCTGTTGGATGACTGGAA ACCAACGGAAAGGACTGGATA
GAPDH TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG

Figure 1

Effects of chronic intravenous infection with P. gingivalis on aortic atherosclerosis in ApoE-/- mice P. gingivalis, Porphyromonas gingivalis; PBS, phosphate buffered saline. Lipid deposition stained with oil red O (A, black arrow) and the percentage of lesion areas in the aortic sinus is shown (B). *P<0.01 vs. PBS group."

Figure 2

ELISA detected the protein expression level of 8-OHdG (A), IL-1β (B), IL-6 (C) and TNF-α (D) in the serum between the PBS control group and the P. gingivalis infection group 8-OHdG, 8-hydroxy-2-deoxyguanosine; Other abbreviations as in Table 1 and Figure 1. *P<0.05, #P<0.01, vs. PBS group."

Figure 3

Comparison of the mediators of oxidative stress and inflammation in the aorta between the control and infected groups Abbreviations as in Table 1. The relative quantity of target mRNA was normalized to the GAPDH mRNA. *P<0.05, #P<0.01 vs. PBS group."

Figure 4

Western blot tested the protein levels of NF-κB in the aorta between the control and P. gingivalis infected groups NF-κB, nuclear factor-kappa B; Other abbreviations as in Figure 1. The relative quantity of protein was normalized to the GAPDH protein. *P<0.05 vs. PBS group."

[1] Cutler CW, Kalmar JR, Genco CA. Pathogenic strategies of the oral anaerobe, Porphyromonas gingivalis[J]. Trends Microbiol, 1995,3(2):45-51.
[2] Holt SC, Kesavalu L, Walker S, et al. Virulence factors of Porphyromonas gingivalis[J]. Periodontol 2000,1999(20):168-238.
[3] DeStefano F, Anda RF, Kahn HS, et al. Dental disease and risk of coronary heart disease and mortality[J]. BMJ, 1993,306(6879):688-691.
[4] Southerland JH, Taylor GW, Moss K, et al. Commonality in chronic inflammatory diseases: Periodontitis, diabetes, and coronary artery disease[J]. Periodontol 2000, 2006,40(1):130-143.
[5] Dogan B, Buduneli E, Emingil G, et al. Characteristics of periodontal microflora in acute myocardial infarction[J]. J Periodontol, 2005,76(5):740-748.
pmid: 15898935
[6] Jain A, Batista EL Jr, Serhan C, et al. Role for periodontitis in the progression of lipid deposition in an animal model[J]. Infect Immun, 2003,71(10):6012-6018.
doi: 10.1128/iai.71.10.6012-6018.2003 pmid: 14500522
[7] Ishihara K, Nabuchi A, Ito R, et al. Correlation between detection rates of periodontopathic bacterial DNA in carotid coronary stenotic artery plaque and in dental plaque samples[J]. J Clin Microbiol, 2004,42(3):1313-1315.
[8] Nakano K, Inaba H, Nomura R, et al. Distribution of Porphyromonas gingivalis fimA genotypes in cardiovascular specimens from Japanese patients[J]. Oral Microbiol Immunol, 2008,23(2):170-172.
[9] Kozarov EV, Dorn BR, Shelburne CE, et al. Human atherosclerotic plaque contains viable invasive Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis[J]. Arterioscler Thromb Vasc Biol, 2005,25(3):e17-e18.
[10] Fukasawa A, Kurita-Ochiai T, Hashizume T, et al. Porphyromonas gingivalis accelerates atherosclerosis in C57BL/6 mice fed a high-fat diet[J]. Immunopharmacol Immunotoxicol, 2012,34(3):470-476.
doi: 10.3109/08923973.2011.627866 pmid: 22047042
[11] Yu H, Qi LT, Liu LS, et al. Association of carotid intima-media thickness and atherosclerotic plaque with periodontal status[J]. J Dent Res, 2014,93(8):744-751.
doi: 10.1177/0022034514538973 pmid: 24935064
[12] Lin G, Chen S, Lei L, et al. Effects of intravenous injection of Porphyromonas gingivalis on rabbit inflammatory immune response and atherosclerosis [J/OL]. Mediators Inflamm, 2015: 364391. doi: 10.1155/2015/364391.
[13] Paigen B, Morrow A, Holmes PA, et al. Quantitative assessment of atherosclerotic lesions in mice[J]. Atherosclerosis, 1987,68(3):231-240.
pmid: 3426656
[14] Bélanger M, Rodrigues PH, Dunn WA, et al. Autophagy: A highway for Porphyromonas gingivalis in endothelial cells[J]. Autophagy, 2006,2(3):165-170.
[15] Iwai T. Periodontal bacteremia and various vascular diseases[J]. J Periodontal Res, 2009,44(6):689-694.
[16] Campbell LA, Rosenfeld ME. Infection and atherosclerosis deve-lopment[J]. Arch Med Res, 2015,46(5):339-350.
doi: 10.1016/j.arcmed.2015.05.006 pmid: 26004263
[17] Mattila KJ, Nieminen MS, Valtonen VV, et al. Association between dental health and acute myocardial infarction[J]. BMJ, 1989,298(6676):779-781.
doi: 10.1136/bmj.298.6676.779 pmid: 2496855
[18] Chiu B. Multiple infections in carotid atherosclerotic plaques[J]. Am Heart J, 1999,138(5 Pt 2):S534-S536.
pmid: 10539867
[19] Haraszthy VI, Zambon JJ, Trevisan M, et al. Identification of periodontal pathogens in atheromatous plaques[J]. J Periodontol, 2000,71(10):1554-1560.
[20] Nakano K, Miyamoto E, Tamura K, et al. Distribution of 10 periodontal bacterial species in children and adolescents over a 7-year period[J]. Oral Dis, 2008,14(7):658-664.
doi: 10.1111/j.1601-0825.2008.01452.x pmid: 18565147
[21] Wada K, Kamisaki Y. Roles of oral bacteria in cardiovascular diseases. From molecular mechanisms to clinical cases: Involvement of Porphyromonas gingivalis in the development of human aortic aneurysm[J]. J Pharmacol Sci, 2010,113(2):115-119.
doi: 10.1254/jphs.09r22fm pmid: 20501967
[22] Miyakawa H, Honma K, Qi M, et al. Interaction of Porphyromonas gingivalis with low-density lipoproteins: implications for a role for periodontitis in atherosclerosis[J]. J Periodontal Res, 2004,39(1):1-9.
[23] Li XY, Wang C, Xiang XR, et al. Porphyromonas gingivalis lipopolysaccharide increases lipid accumulation by affecting CD36 and ATP-binding cassette transporter A1 in macrophages[J]. Oncol Rep, 2013,30(3):1329-1336.
pmid: 23835648
[24] Qi M, Miyakawa H, Kuramitsu HK. Porphyromonas gingivalis induces murine macrophage foam cell formation[J]. Microb Pathog, 2003,35(6):259-267.
pmid: 14580389
[25] Ross R. Atherosclerosis is an inflammatory disease[J]. Am Heart J, 1999,138(5 Pt 2):S419-S420.
[26] Hansson GK. Inflammation and immune response in atherosclerosis[J]. Curr Atheroscler Rep, 1999,1(2):150-155.
pmid: 11122704
[27] Libby P, Ridker PM, Hansson GK. Progress and challenges in translating the biology of atherosclerosis[J]. Nature, 2011,473(7347):317-325.
pmid: 21593864
[28] Ramji DP, Davies TS. Cytokines in atherosclerosis: Key players in all stages of disease and promising therapeutic targets[J]. Cytokine Growth Factor Rev, 2015,26(6):673-685.
doi: 10.1016/j.cytogfr.2015.04.003 pmid: 26005197
[29] Rosenson RS, Elliott M, Stasiv Y, et al. Randomized trial of an inhibitor of secretory phospholipase A2 on atherogenic lipoprotein subclasses in statin-treated patients with coronary heart disease[J]. Eur Heart J, 2011,32(8):999-1005.
doi: 10.1093/eurheartj/ehq374 pmid: 21081550
[30] Hayashi C, Papadopoulos G, Gudino CV, et al. Protective role for TLR4 signaling in atherosclerosis progression as revealed by infection with a common oral pathogen[J]. J Immunol, 2012,189(7):3681-3688.
doi: 10.4049/jimmunol.1201541 pmid: 22956579
[31] Gibson FC 3rd, Ukai T, Genco CA. Engagement of specific innate immune signaling pathways during Porphyromonas gingivalis induced chronic inflammation and atherosclerosis[J]. Front Biosci, 2008(13):2041-2059.
[32] Pan S, Lei L, Chen S, et al. Rosiglitazone impedes Porphyromonas gingivalis-accelerated atherosclerosis by downregulating the TLR/NF-κB signaling pathway in atherosclerotic mice[J]. Int Immunopharmacol, 2014,23(2):701-708.
doi: 10.1016/j.intimp.2014.10.026 pmid: 25445963
[33] Huang CY, Shih CM, Tsao NW, et al. The GroEL protein of Porphyromonas gingivalis regulates atherogenic phenomena in endothelial cells mediated by up-regulating toll-like receptor 4 expression[J]. Am J Transl Res, 2016,8(2):384-404.
pmid: 27158334
[34] Khlgatian M, Nassar H, Chou HH, et al. Fimbria-dependent activation of cell adhesion molecule expression in Porphyromonas gingivalis-infected endothelial cells[J]. Infect Immun, 2002,70(1):257-267.
doi: 10.1128/iai.70.1.257-267.2002 pmid: 11748191
[35] Gitlin JM, Loftin CD. Cyclooxygenase-2 inhibition increases lipopolysaccharide-induced atherosclerosis in mice[J]. Cardiovasc Res, 2009,81(2):400-407.
doi: 10.1093/cvr/cvn286 pmid: 18948273
[36] Huang KT, Kuo L, Liao JC. Lipopolysaccharide activates endothelial nitric oxide synthase through protein tyrosine kinase[J]. Biochem Biophys Res Commun, 1998,245(1):33-37.
doi: 10.1006/bbrc.1998.8384 pmid: 9535778
[37] Obermeier F, Gross V, Scholmerich J, et al. Interleukin-1 production by mouse macrophages is regulated in a feedback fashion by nitric oxide[J]. J Leukoc Biol, 1999,66(5):829-836.
pmid: 10577516
[38] Sorescu D, Weiss D, Lassègue B. Superoxide production and expression of nox family proteins in human atherosclerosis[J]. Circulation, 2002,105(12):1429-1435.
doi: 10.1161/01.cir.0000012917.74432.66 pmid: 11914250
[39] Szöcs K, Lassègue B, Sorescu D, et al. Upregulation of Nox-based NAD(P)H oxidases in restenosis after carotid injury[J]. Arterioscler Thromb Vasc Biol, 2002,22(1):21-27.
doi: 10.1161/hq0102.102189 pmid: 11788456
[40] Anrather J, Racchumi G, Iadecola C. NF-kappaB regulates pha-gocytic NADPH oxidase by inducing the expression of gp91phox[J]. J Biol Chem, 2006,281(9):5657-5667.
doi: 10.1074/jbc.M506172200 pmid: 16407283
[41] Morris KR, Lutz RD, Choi HS, et al. Role of the NF-kappaB signaling pathway and kappaB cis-regulatory elements on the IRF-1 and iNOS promoter regions in mycobacterial lipoarabinomannan induction of nitric oxide[J]. Infect Immun, 2003,71(3):1442-1452.
doi: 10.1128/iai.71.3.1442-1452.2003 pmid: 12595462
[42] Deng WG, Zhu Y, Wu KK. Up-regulation of p300 binding and p50 acetylation in tumor necrosis factor-alpha-induced cyclooxygenase-2 promoter activation[J]. J Biol Chem, 2003,278(7):4770-4777.
doi: 10.1074/jbc.M209286200 pmid: 12471036
[43] Brown K, Gerstberger S, Carlson L, et al. Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation[J]. Science, 1995,267(5203):1485-1488.
doi: 10.1126/science.7878466 pmid: 7878466
[44] Luoma JS, Stralin P, Marklund SL, et al. Expression of extracellular SOD and iNOS in macrophages and smooth muscle cells in human and rabbit atherosclerotic lesions: colocalization with epitopes characteristic of oxidized LDL and peroxynitrite-modified proteins[J]. Arterioscler Thromb Vasc Biol, 1998,18(2):157-167.
doi: 10.1161/01.atv.18.2.157 pmid: 9484979
[45] Morgan MJ, Liu ZG. Crosstalk of reactive oxygen species and NF-kappa B signaling[J]. Cell Res, 2011,21(1):103-115.
doi: 10.1038/cr.2010.178 pmid: 21187859
[46] Stocker R, Keaney JF Jr. Role of oxidative modifications in atherosclerosis[J]. Physiol Rev, 2004,84(4):1381-1478.
doi: 10.1152/physrev.00047.2003 pmid: 15383655
[1] Yajing GAO, Zhengfang LI, Mengsi MA, Lijun WU. Role of the SII and SIRI in risk prediction, disease activity assessment, and prog-nostic evaluation of Behçet disease uveitis [J]. Journal of Peking University (Health Sciences), 2025, 57(6): 1067-1073.
[2] Jiaxin NING, Haoran WANG, Shuhang LUO, Jibo JING, Jianye WANG, Huimin HOU, Ming LIU. Multi-omics analysis of the relationship between oxidative stress-related gene and prostate cancer [J]. Journal of Peking University (Health Sciences), 2025, 57(4): 633-643.
[3] Jing HE,Zhongze FANG,Ying YANG,Jing LIU,Wenyao MA,Yong HUO,Wei GAO,Yangfeng WU,Gaoqiang XIE. Relationship between lipid metabolism molecules in plasma and carotid atheroscle-rotic plaques, traditional cardiovascular risk factors, and dietary factors [J]. Journal of Peking University (Health Sciences), 2024, 56(4): 722-728.
[4] Chang SHU,Ye HAN,Yuzhe SUN,Zaimu YANG,Jianxia HOU. Changes of parameters associated with anemia of inflammation in patients with stage Ⅲ periodontitis before and after periodontal initial therapy [J]. Journal of Peking University (Health Sciences), 2024, 56(1): 45-50.
[5] Chen-guang ZHANG,Xu-yan CHEN,Sheng WU,Li-li FENG,Yan WANG,Yu CHEN,Min DUAN,Ke WANG,Lin-lin SONG. Internal carotid artery pseudoaneurysm caused by parapharyngeal abscess: A case report [J]. Journal of Peking University (Health Sciences), 2023, 55(6): 1135-1138.
[6] Xiu-rui LIANG,Xue-chun SHAN,Jing GUAN,Rui ZHANG,Jing YANG,Yi ZHANG,Jia-qi JIN,Yu-xin ZHANG,Fan XU,Ji-hua FU. Role of hyperglycemia-induced 5-hydroxytryptamine degradation of hepatic stellate cells in hepatic inflammation and fibrosis induced by type 2 diabetes mellitus [J]. Journal of Peking University (Health Sciences), 2022, 54(6): 1141-1150.
[7] YUAN Lin-tian,MA Li-sha,LIU Run-yuan,QI wei,ZHANG Lu-dan,WANG Gui-yan,WANG Yu-guang. Computer simulation of molecular docking between methylene blue and some proteins of Porphyromonas gingivalis [J]. Journal of Peking University (Health Sciences), 2022, 54(1): 23-30.
[8] BAI Feng,HE Yi-fan,NIU Ya-nan,YANG Ruo-juan,CAO Jing. Effects of ultrafine particulates on cardiac function in rat isolated heart [J]. Journal of Peking University (Health Sciences), 2021, 53(2): 240-245.
[9] CHEN Huai-an,LIU Shuo,LI Xiu-jun,WANG Zhe,ZHANG Chao,LI Feng-qi,MIAO Wen-long. Clinical value of inflammatory biomarkers in predicting prognosis of patients with ureteral urothelial carcinoma [J]. Journal of Peking University (Health Sciences), 2021, 53(2): 302-307.
[10] YANG Lin-cheng,ZHANG Rui-tao,GUO Li-jun,XIAO Han,ZU Ling-yun,ZHANG You-yi,CHENG Qin,ZHAO Zhi-ling,GE Qing-gang,GAO Wei. Hypoxia and inflammation are risk factors for acute myocardial injury in patients with coronavirus disease 2019 [J]. Journal of Peking University (Health Sciences), 2021, 53(1): 159-166.
[11] Teng-fei LIU,Tao LIN,Li-hui REN,Guang-ping LI,Jian-jun PENG. Association between CMTM5 gene and coronary artery disease and the relative mechanism [J]. Journal of Peking University (Health Sciences), 2020, 52(6): 1082-1087.
[12] Ping WANG,Jing SONG,Xiang-yu FANG,Xin LI,Xu LIU,Yuan JIA,Zhan-guo LI,Fan-lei HU. Role of erythroblast-like Ter cells in the pathogenesis of collagen-induced arthritis [J]. Journal of Peking University(Health Sciences), 2019, 51(3): 445-450.
[13] Li-ping DUAN,Zhao-xia ZHENG,Yu-hui ZHANG,Jie DONG. Association of malnutrition-inflammation-cardiovascular disease with cognitive deterioration in peritoneal dialysis patients [J]. Journal of Peking University(Health Sciences), 2019, 51(3): 510-518.
[14] Jing ZHANG,Su-fang LI,Hong CHEN,Jun-xian SONG. Role of miR-106b-5p in the regulation of gene profiles in endothelial cells [J]. Journal of Peking University(Health Sciences), 2019, 51(2): 221-227.
[15] GAI Xiao-yan, CHANG Chun, WANG Juan, LIANG Ying, LI Mei-jiao, SUN Yong-chang,HE Bei, YAO Wan-zhen. Airway inflammation and small airway wall remodeling in neutrophilic asthma [J]. Journal of Peking University(Health Sciences), 2018, 50(4): 645-650.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!