Journal of Peking University (Health Sciences) ›› 2022, Vol. 54 ›› Issue (2): 320-326. doi: 10.19723/j.issn.1671-167X.2022.02.020

Previous Articles     Next Articles

Knockdown of long non-coding RNA MIR4697 host gene inhibits adipogenic differentiation in bone marrow mesenchymal stem cells

SHUAI Ting1,LIU Juan2,GUO Yan-yan1,JIN Chan-yuan1,()   

  1. 1. Second Clinical Division, Peking University School and Hospital of Stomatology & National Center of Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Research Center of Oral Biomaterials and Digital Medical Devices & Beijing Key Laboratory of Digital Stomatology & NHC Research Center of Engineering and Technology for Computerized Dentistry & NMPA Key Laboratory for Dental Materials, Beijing 100081, China
    2. Department of Stomatology, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, China
  • Received:2020-03-30 Online:2022-04-18 Published:2022-04-13
  • Contact: Chan-yuan JIN E-mail:jinchanyuanjcy@bjmu.edu.cn
  • Supported by:
    National Natural Science Foundation of China(81800942);Chinese Postdoctoral Science Foundation(2018M631442)

RICH HTML

  

Abstract:

Objective: To preliminarily investigate the role of long non-coding RNA (lncRNA) MIR4697 host gene (MIR4697HG) in regulating the adipogenic differentiation of bone marrow mesenchymal stem cells (BMSCs). Methods: For adipogenic differentiation, BMSCs were induced in adipogenic media for 10 days. The mRNA expression levels of lncRNA MIR4697HG and adipogenic marker genes including peroxisome proliferator-activated receptor γ (PPARγ), CCAAT/enhanced binding protein α (CEBP/α) and adiponectin (ADIPQ) were detected by quantitative real-time polymerase chain reaction (qRT-PCR) at different time points (0, 1, 2, 3, 5, 7, 10 days). The MIR4697HG stable knockdown-BMSC cell line was generated by infection of MIR4697HG shRNA-containing lentiviruses. To avoid off-target effect, two target sequences (shMIR4697HG-1, shMIR4697HG-2) were designed. And then cells were induced to differentiate in adipogenic medium. Oil red O staining, Western blot and qRT-PCR were used to detect the effect of MIR4697HG knockdown on adipogenic differentiation of BMSCs. Results: The mRNA expression level of MIR4697HG was significantly increased during adipogenic differentiation (P<0.01), and adipogenic differentiation of BMSCs was evidenced by upregulated mRNA levels of specific adipogenesis-related genes including PPARγ, CEBP/α and ADIPQ. Observed by fluorescence microscopy, more than 90% transfected target cells expressed green fluorescent protein successfully after shMIR4697HG-1 group, shMIR4697HG-2 group and shNC group transfection for 72 h. And the transfection efficiency of MIR4697HG examined by qRT-PCR was above 60%. Then the BMSCs were treated with adipogenic media for 7 days and showed that the mRNA expression levels of adipogenesis-related genes including PPARγ, CEBP/α and ADIPQ were significantly decreased in the MIR4697HG knockdown group (P<0.01), while the expression levels of PPARγ and CEBP/α proteins were decreased remarkably as well (P<0.01). Consistently, MIR4697HG knockdown BMSCs formed less lipid droplets compared with the control BMSCs, which further demonstrated that MIR4697HG knockdown inhibited adipogenic differentiation of BMSCs. Conclusion: lncRNA MIR4697HG played a crucial role in regulating the adipogenic differentiation of BMSCs, and MIR4697HG knockdown significantly inhibited the adipogenic differentiation of BMSCs. These data may suggest that lncRNA MIR4697HG could serve as a therapeutic potential target for the aberrant adipogenic differentiation-associated disorders including osteoporosis.

Key words: Bone marrow mesenchymal stem cells, Long non-coding RNA, MIR4697HG, Adipogenic differentiation

CLC Number: 

  • R34

Table 1

Primer sequences used for qRT-PCR"

lncRNA name Forward primer sequences(5' to 3') Reverse primer sequences(5' to 3')
MIR4697HG GAAGTGTGTGTGCAGGCTTG GGAAAAGGCTCTGTCGTGGA
GAPDH GGTCACCAGGGCTGCTTTTA GGATCTCGCTCCTGGAAGATG
PPARγ GAGGAGCCTAAGGTAAGGAG GTCATTTCGTTAAAGGCTGA
CEBP/α CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
ADIPQ CTTGCAAGAACCGGCTCAGATCCTCCC GAGCTGTTCTACTGCTATTAGCTCTGC

Table 2

shRNA sequences of lentiviruses"

shRNA shRNA sequences(5' to 3')
shNC CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAG
shMIR4697HG-1 GTGCCCTCTGCACACATATATCTCGAGATATATGTGTGCAGAGGGCAC
shMIR4697HG-2 TGCTGTACCAAAGCCTTATATCTCGAGATATAAGGCTTTGGTACAGCA

Figure 1

Expression level of MIR4697HG and adipogenesis-related genes after adipogenic induction in BMSCs BMSCs, bone marrow mesenchymal stem cells; The other abbreviations as in Table 1.* P<0.05, vs. 0 d; A, the expression level of MIR4697HG after 0, 1, 2, 3, 5, 7, 10 days of adipogenic induction in BMSCs; B, the expression level of PPARγ after 0, 1, 2, 3, 5, 7, 10 days of adipogenic induction in BMSCs; C, the expression level of CEBP/α after 0, 1, 2, 3, 5, 7, 10 days of adipogenic induction in BMSCs; D, the expression level of ADIPQ after 0, 1, 2, 3, 5, 7, 10 days of adipogenic induction in BMSCs."

Figure 2

Examination of lentivirus transfection effect and efficiency GFP, green fluorescent protein;MIR4697HG, MIR4697 host gene.*P<0.05; vs. shNC group; A, the transfection effect was observed by fluorescence microscopy 24 hours after shMIR4697HG-1 group, shMIR4697HG-2 group and shNC group transfection;B, the transfection efficiency of MIR4697HG was examined by qRT-PCR."

Figure 3

Results after adipogenic induction in MIR4697HG-knockdown BMSCs PM, proliferation medium; AM, adipogenic medium; BMSCs, bone marrow mesenchymal stem cells; The other abbreviations as in Table 1; *P<0.05; vs. shNC group; A, qRT-PCR results after adipogenic induction in MIR4697HG-knockdown BMSCs; B, Western blot results after adipogenic induction in MIR4697HG-knockdown BMSCs; C, oil red staining results after adipogenic induction in MIR4697HG-knockdown BMSCs."

[1] Pino AM, Rosen CJ, Rodríguez JP. In osteoporosis, differentiation of mesenchymal stem cells (MSCs) improves bone marrow adipogenesis[J]. Biol Res, 2012, 45(3):279-287.
doi: 10.4067/S0716-97602012000300009
[2] Taylor DH, Chu TJ, Spektor R, et al. Long non-coding RNA regulation of reproduction and development[J]. Mol Reprod Dev, 2015, 82(12):932-956.
doi: 10.1002/mrd.22581 pmid: 26517592
[3] Sun M, Kraus WL. From discovery to function: the expanding roles of long non-coding RNAs in physiology and disease[J]. Endocr Rev, 2015, 36(1):25-64.
doi: 10.1210/er.2014-1034
[4] Luan A, Paik KJ, Li J, et al. RNA sequencing for identification of differentially expressed noncoding transcripts during adipogenic differentiation of adipose-derived stromal cells[J]. Plast Reconstr Surg, 2015, 136(4):752-763.
doi: 10.1097/PRS.0000000000001582
[5] Liu Y, Wang Y, He X, et al. LncRNA TINCR/miR-31-5p/C/EBP-α feedback loop modulates the adipogenic differentiation process in human adipose tissue-derived mesenchymal stem cells[J]. Stem Cell Res, 2018, 32:35-42.
doi: 10.1016/j.scr.2018.08.016
[6] Mao YH, Shen G, Su ZP, et al. RAD21 inhibited transcription of tumor suppressor MIR4697HG and led to glioma tumorigenesis[J]. Biomed Pharmacother, 2020, 123:109759.
doi: 10.1016/j.biopha.2019.109759
[7] Zhang LQ, Yang SQ, Wang Y, et al. Long noncoding RNA MIR4697HG promotes cell growth and metastasis in human ovarian cancer[J]. Anal Cell Pathol (Amst), 2017, 2017(4):1-9.
[8] Park SB, Kim J, Jeong JH, et al. Prevalence and incidence of osteoporosis and osteoporotic vertebral fracture in Korea: nationwide epidemiological study focusing on differences in socioecono-mic status[J]. Spine, 2016, 41(4):328.
doi: 10.1097/BRS.0000000000001291
[9] Montagner RLM, Martinez CR, Canterle DOL, et al. Factors related with osteoporosis treatment in postmenopausal women[J]. Medicine, 2018, 97(28):e11524.
doi: 10.1097/MD.0000000000011524
[10] Zhou X, Liu Z, Huang B, et al. Orcinol glucoside facilitates the shift of MSC fate to osteoblast and prevents adipogenesis via Wnt/beta-catenin signaling pathway[J]. Drug Des Devel Ther, 2019, 13:2703-2713.
doi: 10.2147/DDDT
[11] Crockett JC, Mellis DJ, Scott DI, et al. New knowledge on critical osteoclast formation and activation pathways from study of rare genetic diseases of osteoclasts: focus on the RANK/RANKL axis[J]. Osteoporos Int, 2011, 22(1):1-20.
doi: 10.1007/s00198-010-1272-8 pmid: 20458572
[12] Lorenzo J. The many ways of osteoclast activation[J]. J Clin Invest, 2017, 127(7):2530-2532.
doi: 10.1172/JCI94606 pmid: 28530641
[13] Wang QL, Li HF, Wang DP, et al. Effect of GGCX on the differentiation function of osteoporosis bone marrow mesenchymal stem cells through regulating TGFbeta/smad signaling pathway[J]. Eur Rev Med Pharmacol Sci, 2019, 23(17):7224-7231.
[14] Aimaiti A, Wahafu T, Keremu A, et al. Strontium ameliorates glucocorticoid inhibition of osteogenesis via the ERK signaling pathway[J]. Biol Trace Elem Res, 2020, 197(2):591-598.
doi: 10.1007/s12011-019-02009-6
[15] Chen X, Zhi X, Yin Z, et al. 18β-glycyrrhetinic acid inhibits osteoclastogenesis in vivo and in vitro by blocking RANKL-mediated RANK-TRAF6 interactions and NF-κB and MAPK signaling pathways[J]. Front Pharmacol, 2018, 9:647.
doi: 10.3389/fphar.2018.00647
[16] Chen X, He F, Zhong DY, et al. Acoustic-frequency vibratory stimulation regulates the balance between osteogenesis and adipogenesis of human bone marrow-derived mesenchymal stem cells[J]. Biomed Res Int, 2015, 2015:540731.
[17] James AW. Review of signaling pathways governing MSC osteoge-nic and adipogenic differentiation[J]. Scientifica, 2013, 2013:684736.
[18] Shang GW, Wang YD, Xu Y, et al. Long non-coding RNA TCONS_00041960 enhances osteogenesis and inhibits adipogenesis of rat bone marrow mesenchymal stem cell by targeting miR-204-5p and miR-125a-3p[J]. J Cell Physiol, 2018, 233(8):6041-6051.
doi: 10.1002/jcp.v233.8
[19] Wang YJ, Liu WT, Liu YD, et al. Long noncoding RNA H19 mediates LCoR to impact the osteogenic and adipogenic differentiation of mBMSCs in mice through sponging miR-188[J]. J Cell Physiol, 2018, 233(9):7435-7446.
doi: 10.1002/jcp.v233.9
[20] Yang L, Li Y, Gong R, et al. The long non-coding RNA-ORLNC1 regulates bone mass by directing mesenchymal stem cell fate[J]. Mol Ther, 2019, 27(2):394-410.
doi: S1525-0016(18)30586-0 pmid: 30638773
[21] Yuan HR, Xu XW, Feng X, et al. A novel long noncoding RNA PGC1β-OT1 regulates adipocyte and osteoblast differentiation through antagonizing miR-148a-3p[J]. Cell Death Differ, 2019, 26(10):2029-2045.
doi: 10.1038/s41418-019-0296-7
[1] Liting ZENG, Kaiyuan CHENG, Zhongning LIU, Jian LI, Jingwen YANG, Ting JIANG. miR-488-5p promotes osteogenic and neurogenic differentiation of rat bone marrow mesenchymal stem cells and enhances neuralized bone regeneration [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 10-21.
[2] Qiushi XU, Tong LIU, Junjie WANG. Ferroptosis-related long non-coding RNA to predict the clinical outcome of non-small cell lung cancer after radiotherapy [J]. Journal of Peking University (Health Sciences), 2025, 57(3): 569-577.
[3] Ting SHUAI, Yanyan GUO, Chunping LIN, Xiaomei HOU, Chanyuan JIN. Knockdown of NPTX1 promotes osteogenic differentiation of human bone marrow mesenchymal stem cells [J]. Journal of Peking University (Health Sciences), 2025, 57(1): 7-12.
[4] Xiang-song BAI,Long-wei LV,Yong-sheng ZHOU. Tribbles pseudokinase 3 inhibits the adipogenic differentiation of human adipose-derived mesenchymal stem cells [J]. Journal of Peking University(Health Sciences), 2020, 52(1): 1-9.
[5] Jing XIE,Yu-ming ZHAO,Nan-quan RAO,Xiao-tong WANG,Teng-jiao-zi FANG,Xiao-xia LI,Yue ZHAI,Jing-zhi LI,Li-hong GE,Yuan-yuan WANG. Comparative study of differentiation potential of mesenchymal stem cells derived from orofacial system into vascular endothelial cells [J]. Journal of Peking University(Health Sciences), 2019, 51(5): 900-906.
[6] Fei-long YANG,Kai HONG,Guo-jiang ZHAO,Cheng LIU,Yi-meng SONG,Lu-lin MA. Construction of prognostic model and identification of prognostic biomarkers based on the expression of long non-coding RNA in bladder cancer via bioinformatics [J]. Journal of Peking University(Health Sciences), 2019, 51(4): 615-622.
[7] Xia LIU,Ying ni LI,Xiao li SUN,Qing lin PENG,Xin LU,Guo chun WANG. Effects of integrin metalloproteinases on osteogenic differentiation [J]. Journal of Peking University(Health Sciences), 2018, 50(6): 962-967.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!