Journal of Peking University (Health Sciences) ›› 2023, Vol. 55 ›› Issue (2): 217-227. doi: 10.19723/j.issn.1671-167X.2023.02.004

Previous Articles     Next Articles

Read-through circular RNA rt-circ-HS promotes hypoxia inducible factor 1α expression and renal carcinoma cell proliferation, migration and invasiveness

Yun-yi XU1,Zheng-zheng SU1,Lin-mao ZHENG1,Meng-ni ZHANG1,Jun-ya TAN1,2,Ya-lan YANG1,Meng-xin ZHANG1,Miao XU1,Ni CHEN1,2,Xue-qin CHEN1,2,Qiao ZHOU1,2,*()   

  1. 1. Department of Pathology, West China Hospital, Sichuan University, Chengdu 610041, China
    2. Research Laboratory of Pathology, West China Hospital, Sichuan University, Chengdu 610041, China
  • Received:2022-11-16 Online:2023-04-18 Published:2023-04-12
  • Contact: Qiao ZHOU E-mail:zhou_qiao@hotmail.com

RICH HTML

  

Abstract:

Objective: To identify and characterize read-through RNAs and read-through circular RNAs (rt-circ-HS) derived from transcriptional read-through hypoxia inducible factor 1α (HIF1α) and small nuclear RNA activating complex polypeptide 1 (SNAPC1) the two adjacent genes located on chromosome 14q23, in renal carcinoma cells and renal carcinoma tissues, and to study the effects of rt-circ-HS on biological behavior of renal carcinoma cells and on regulation of HIF1α. Methods: Reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing were used to examine expression of read-through RNAs HIF1α-SNAPC1 and rt-circ-HS in different tumor cells. Tissue microarrays of 437 different types of renal cell carcinoma (RCC) were constructed, and chromogenic in situ hybridization (ISH) was used to investigate expression of rt-circ-HS in different RCC types. Small interference RNA (siRNA) and artificial overexpression plasmids were designed to examine the effects of rt-circ-HS on 786-O and A498 renal carcinoma cell proliferation, migration and invasiveness by cell counting kit 8 (CCK8), EdU incorporation and Transwell cell migration and invasion assays. RT-PCR and Western blot were used to exa-mine expression of HIF1α and SNAPC1 RNA and proteins after interference of rt-circ-HS with siRNA, respectively. The binding of rt-circ-HS with microRNA 539 (miR-539), and miR-539 with HIF1α 3′ untranslated region (3′ UTR), and the effects of these interactions were investigated by dual luciferase reporter gene assays. Results: We discovered a novel 1 144 nt rt-circ-HS, which was derived from read-through RNA HIF1α-SNAPC1 and consisted of HIF1α exon 2-6 and SNAPC1 exon 2-4. Expression of rt-circ-HS was significantly upregulated in 786-O renal carcinoma cells. ISH showed that the overall positive expression rate of rt-circ-HS in RCC tissue samples was 67.5% (295/437), and the expression was different in different types of RCCs. Mechanistically, rt-circ-HS promoted renal carcinoma cell proliferation, migration and invasiveness by functioning as a competitive endogenous inhibitor of miR-539, which we found to be a potent post-transcriptional suppressor of HIF1α, thus promoting expression of HIF1α. Conclusion: The novel rt-circ-HS is highly expressed in different types of RCCs and acts as a competitive endogenous inhibitor of miR-539 to promote expression of its parental gene HIF1α and thus the proliferation, migration and invasion of renal cancer cells.

Key words: Read-through circular RNA HIF1α-SNAPC1, Renal cell carcinoma, Hypoxia inducible factor 1α, Small nuclear RNA activating complex polypeptide 1, microRNA 539

CLC Number: 

  • R365

Table 1

Primer sequence of RT-PCR"

mRNA name Primer sequence(5′-3′) Length/bp
rt-circ-HS
(divergent primer)
FP:TCACTTTACAGCAATGCCCA
RP:TCCTCACACGCAAATAGCTGA
306
rt-circ-HS
(convergent primer)
FP:GTGAACCCATTCCTCACCCA
RP:AGCACCAACTCTGATCTGGA
209
rt-circ-HS full length
(divergent primer)
FP:CACTTTACAGCAATGCCCA
RP:TCAGCACCAAGCAGGTCATAGG
761
rt-circ-HS full length
(convergent primer)
FP:GGTATAAGAAACCACCTATGAC
RP:CACACGATCACTTGGGTCC
518
HIF1α FP:GATGTAATGCTCCCCTCACC
RP:ATTCATTGACCATATCACTATCCAC
295
SNAPC1 FP:CAGGAGACGGACAGTGTACG
RP:TCGCCAAGCCAAAGCTAAAGC
138
BNIP3 FP:ACCAACAGGGCTTCTGAAAC
RP:GAGGGTGGCCGTGCGC
202
VEGF FP:AGGAGGGCAGAATCATCACG
RP:GCACACAGGATGGCTTGAAGA
140
β-actin FP:CTGGCACCACACCTTCTACAATG
RP:CCTCGTAGATGGGCACAGTGTG
248
U6 FP: TGGAACGATACAGAGAAGATTAGCA
RP:AACGCTTCACGAATTTGCGT
TaqMan probe:FAM-CCCCTGCGCAAGGA-MGB
75
miR-539 FP: CGGCGGGAGAAATTATCCT
RP:GTGCAGGGTCCGAGGT
TaqMan probe:FAM-ACTGGATACGACACTCCACACCA-MGB
74

Figure 1

Discovery and characterization of rt-circ-HS A, B, bioinformatics and sequencing analysis identified three novel read-through RNAs derived from HIF1α and SNAPC1, with respective genomic sequence structures; C, structure and sequencing of the novel rt-circ-HS derived from HIF1α-SNAPC1 read-through. The junction site of rt-circ-HS was verified by Sanger sequencing; D, rt-circ-HS full length convergent primers and divergent primers were designed for RT-PCR to characterize the rt-circ-HS derived from HIF1α exon 6-SNAPC1 exon 2 read-through RNA; E, the read-through RNAs of HIF1α exon 10-SNAPC1 exon 2 and HIF1α exon 9-SNAPC1 exon 2 did not form circRNAs. rt-circ-HS, read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; RT-PCR, reverse transcription-polymerase chain reaction; circRNA, circular RNA."

Figure 2

Expression of rt-circ-HS in different cell lines and renal cell carcinoma tissues A, RT-PCR showed that HIF1α exon 6-SNAPC1 exon 2 read-through RNA was present in different renal cancer cells, including A498, ACHN, 786-O, 769-P, OS-RC-2, normal renal epithelial cell HK-2, and human embryonic kidney cell HEK-293. The circular rt-circ-HS was highly expressed in renal cancer cell 786-O, weakly expressed in human embryonic kidney cell HEK-293, and was very low in other cells; B, HIF1α exon 6-SNAPC1 exon 2 read-through RNA, but not the circular rt-circ-HS was found in various cells lines, including prostate cancer cells (PC3, DU45, 22RV1), prostate epithelial cells (RWPE-1), bladder cancer cells (T24), cervical cancer cells (HeLa), glioma cells (U251, U87), astrocytes (HA) and microglia cells (HMC3); C, chromogenic ISH showed high expression of rt-circ-HS in different renal cell carcinoma tissue samples in tissue microarrays, the blue-purple ISH signals indicated the positive signal, and the nuclei were stained green. For each RCC type, low power fields (×40) were shown with insets of high power fields (×400). RT-PCR, reverse transcription-polymerase chain reaction; rt-circ-HS, read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; ISH, in situ hybridization; ccRCC, clear cell renal cell carcinoma; pRCC, papillary renal cell carcinoma; chRCC, chromophobe renal cell carcinoma; TFE3-RCC, TFE3-translocation renal cell carcinoma; FH-RCC, FH-deficient renal cell carcinoma."

Figure 3

Effects of rt-circ-HS on biological behavior of renal carcinoma cells A, CCK-8 assays showed that rt-circ-HS promoted the survival of renal cell carcinoma cells; B, EdU assays demonstrated rt-circ-HS promoted the proli-feration of renal cell carcinoma cells (immunofluorescence ×200), EdU positivily were shown by bar graph (* P < 0.001); C, Transwell cell migration assays demonstrating rt-circ-HS promoted migration of renal cell carcinoma cells (crystal violet staining ×200), the bar graph showed the number of transmembrane cells in each group(* P < 0.001); D, Transwell cell invasion assays showed that rt-circ-HS promoted invasion of renal cell carcinoma cells (crystal violet staining ×200), the bar graph showed the number of transmembrane cells in each group (* P < 0.001). CCK8, cell counting kit 8; EdU, 5-ethynyl-2'-deoxyuridine; rt-circ-HS, read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; si-NC, small interference RNA negative control; si-rt-circ-HS, small interference RNA of rt-circ-HS; rt-circ-HS-OE, overexpression plasmid of rt-circ-HS."

Figure 4

Regulation of parental genes HIF1α and SNAPC1 by interfering rt-circ-HS A, si-RNA were used to knock down rt-circ-HS in 786-O cells, which resulted in downregulation of mRNA expressions of HIF1α, SNAPC1, BNIP3 and VEGF, whereas artificial rt-circ-HS-OE in A498 cells promoted the mRNA expression of HIF1α, SNAPC1, BNIP3 and VEGF; B, Western blot showed that rt-circ-HS promoted the protein expression of HIF1α and SNAPC1. RT-PCR, reverse transcription-polymerase chain reaction; si-RNA, small interference RNA; si-NC, small interference RNA negative control; si-rt-circ-HS, small interference RNA of rt-circ-HS; rt-circ-HS-OE, overexpression of rt-circ-HS; rt-circ-HS: read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; BNIP3, BCL2 interacting protein 3; VEGF, vascular endothelial growth factor."

Figure 5

Promotion of HIF1α expression through competitive inhibition of miR-539 by rt-circ-HS A, miR-539 binding sequence was present in both the rt-circ-HS junction site and the HIF1α 3′UTR (703-715 nt) by bioinformatics analysis; B, expression of miR-539 (U6 as internal control) was increased and the mRNA of HIF1α was down-regulated (β-actin as internal control) by miR-539 mimic transfection in 786-O cells (** P < 0.01, *** P < 0.001); C, dual luciferase reporter gene assays showing that miR-539 mimics suppressed reporter gene activity of pGL3-circ-HS-WT, but not pGL3-circ-HS-MUT (+, plasmids or mimics added at transfection; -, plasmids or mimics were not added; *** P < 0.001); D, dual luciferase reporter gene assays demonstrating miR-539 mimics suppressed reporter gene activity of wild-type pGL3-HIF1α-WT, but not mutated pGL3-HIF1α-MUT. Simultaneous transfection with pGL3-circ-HS-WT, but not pGL3-circ-HS-MUT, reversed the inhibitory effects of miR-539 mimic on reporter gene activity of pGL3-HIF1α-WT, but not the pGL3-HIF1α-MUT (+, plasmids or mimics added at transfection; -, plasmids or mimics were not added; * P < 0.05, ** P < 0.01); E, schematic summary of the major findings of the present study. RT-PCR, reverse transcription-polymerase chain reaction; Q-PCR, real-time quantitative polymerase chain reaction; rt-circ-HS, read-through circular RNA HIFα-SNAPC1; miR-539, micro RNA 539; 3′ UTR, 3′ untranslated region; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; BNIP3, BCL2 interacting protein 3; VEGF, vascular endothelial growth factor; U6, U6 small nuclear RNA; WT, wild type; MUT, mutation."

1 Zhou WY , Cai ZR , Liu J , et al. Circular RNA: Metabolism, functions and interactions with proteins[J]. Mol Cancer, 2020, 19 (1): 172.
doi: 10.1186/s12943-020-01286-3
2 Chen Q , Liu T , Bao Y , et al. CircRNA cRAPGEF5 inhibits the growth and metastasis of renal cell carcinoma via the miR-27a-3p/TXNIP pathway[J]. Cancer Lett, 2020, 469, 68- 77.
doi: 10.1016/j.canlet.2019.10.017
3 Mao W , Wang K , Xu B , et al. ciRS-7 is a prognostic biomarker and potential gene therapy target for renal cell carcinoma[J]. Mol Cancer, 2021, 20 (1): 142- 155.
doi: 10.1186/s12943-021-01443-2
4 van Zonneveld AJ , Kolling M , Bijkerk R , et al. Circular RNAs in kidney disease and cancer[J]. Nat Rev Nephrol, 2021, 17 (12): 814- 826.
doi: 10.1038/s41581-021-00465-9
5 Zhang Y , Gong M , Yuan H , et al. Chimeric transcript generated by cis-splicing of adjacent genes regulates prostate cancer cell proliferation[J]. Cancer Discov, 2012, 2 (7): 598- 607.
doi: 10.1158/2159-8290.CD-12-0042
6 Grosso AR , Leite AP , Carvalho S , et al. Pervasive transcription read-through promotes aberrant expression of oncogenes and RNA chimeras in renal carcinoma[J]. Elife, 2015, 4, e09214.
doi: 10.7554/eLife.09214
7 Pflueger D , Mittmann C , Dehler S , et al. Functional characterization of BC039389-GATM and KLK4-KRSP1 chimeric read-through transcripts which are up-regulated in renal cell cancer[J]. BMC Genomics, 2015, 16 (1): 247.
doi: 10.1186/s12864-015-1446-z
8 Chen N , Zhou Q . Constructing tissue microarrays without prefabricating recipient blocks: A novel approach[J]. Am J Clin Pathol, 2005, 124 (1): 103- 107.
doi: 10.1309/LHCJRFBUH8Q6QD3N
9 Turajlic S , Swanton C , Boshoff C . Kidney cancer: The next decade[J]. J Exp Med, 2018, 215 (10): 2477- 2479.
doi: 10.1084/jem.20181617
10 Siegel RL , Miller KD , Fuchs HE , et al. Cancer statistics 2022[J]. CA Cancer J Clin, 2022, 72 (1): 7- 33.
doi: 10.3322/caac.21708
11 Garje R , Elhag D , Yasin HA , et al. Comprehensive review of chromophobe renal cell carcinoma[J]. Crit Rev Oncol Hematol, 2021, 160, 103287.
doi: 10.1016/j.critrevonc.2021.103287
12 Ji SQ , Su XL , Cheng WL , et al. Down-regulation of CD74 inhi-bits growth and invasion in clear cell renal cell carcinoma through HIF-1α pathway[J]. Urol Oncol, 2014, 32 (2): 153- 161.
doi: 10.1016/j.urolonc.2012.09.013
13 Hu CJ , Wang LY , Chodosh LA , et al. Differential roles of hypo-xia-inducible factor 1alpha (HIF-1alpha) and HIF-2alpha in hypoxic gene regulation[J]. Mol Cell Biol, 2003, 23 (24): 9361- 9374.
doi: 10.1128/MCB.23.24.9361-9374.2003
14 Shen C , Beroukhim R , Schumacher SE , et al. Genetic and functional studies implicate HIF1alpha as a 14q kidney cancer suppressor gene[J]. Cancer Discov, 2011, 1 (3): 222- 235.
doi: 10.1158/2159-8290.CD-11-0098
15 Shinojima T , Oya M , Takayanagi A , et al. Renal cancer cells lacking hypoxia inducible factor (HIF)-1alpha expression maintain vascular endothelial growth factor expression through HIF-2alpha[J]. Carcinogenesis, 2007, 28 (3): 529- 536.
16 Swiatek M , Jancewicz I , Kluebsoongnoen J , et al. Various forms of HIF-1alpha protein characterize the clear cell renal cell carcinoma cell lines[J]. IUBMB Life, 2020, 72 (6): 1220- 1232.
doi: 10.1002/iub.2281
17 Vidal AF . Read-through circular RNAs reveal the plasticity of RNA processing mechanisms in human cells[J]. RNA Biol, 2020, 17 (12): 1823- 1826.
doi: 10.1080/15476286.2020.1805233
18 Yang X , Ye T , Liu H , et al. Expression profiles, biological functions and clinical significance of circRNAs in bladder cancer[J]. Mol Cancer, 2021, 20 (1): 4.
doi: 10.1186/s12943-020-01300-8
19 Wu X , Zhou J , Zhao L , et al. CircCYP24A1 hampered malignant phenotype of renal cancer carcinoma through modulating CMTM-4 expression via sponging miR-421[J]. Cell Death Dis, 2022, 13 (2): 190.
doi: 10.1038/s41419-022-04623-0
20 Wang X , Xing L , Yang R , et al. The circACTN4 interacts with FUBP1 to promote tumorigenesis and progression of breast cancer by regulating the expression of proto-oncogene MYC[J]. Mol Cancer, 2021, 20 (1): 91.
doi: 10.1186/s12943-021-01383-x
21 Abdelmohsen K , Panda AC , Munk R , et al. Identification of HuR target circular RNAs uncovers suppression of PABPN1 translation by CircPABPN1[J]. RNA Biol, 2017, 14 (3): 361- 369.
doi: 10.1080/15476286.2017.1279788
22 Khan FA , Nsengimana B , Khan NH , et al. Chimeric peptides/proteins encoded by circRNA: An update on mechanisms and functions in human cancers[J]. Front Oncol, 2022, 12, 781270.
doi: 10.3389/fonc.2022.781270
23 Pintarelli G , Dassano A , Cotroneo CE , et al. Read-through transcripts in normal human lung parenchyma are down-regulated in lung adenocarcinoma[J]. Oncotarget, 2016, 7 (19): 27889- 27898.
doi: 10.18632/oncotarget.8556
24 Choi ES , Lee H , Lee CH , et al. Overexpression of KLHL23 protein from read-through transcription of PHOSPHO2-KLHL23 in gastric cancer increases cell proliferation[J]. FEBS Open Bio, 2016, 6 (11): 1155- 1164.
doi: 10.1002/2211-5463.12136
25 Wang L , Xiong X , Yao Z , et al. Chimeric RNA ASTN2-PAPPA(as) aggravates tumor progression and metastasis in human esophageal cancer[J]. Cancer Lett, 2021, 501, 1- 11.
doi: 10.1016/j.canlet.2020.10.052
26 Qin F , Zhang Y , Liu J , et al. SLC45A3-ELK4 functions as a long non-coding chimeric RNA[J]. Cancer Lett, 2017, 404, 53- 61.
doi: 10.1016/j.canlet.2017.07.007
[1] Haoming YIN, Zijie WANG, Fan SHU, Zhanyi ZHANG, Hui LIANG, Shudong ZHANG. Expression and significance of the FABP6 long transcript in clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2026, 58(2): 393-398.
[2] Boda GUO, Min LU, Guoliang WANG, Hongxian ZHANG, Lei LIU, Xiaofei HOU, Lei ZHAO, Xiaojun TIAN, Shudong ZHANG. Clinicopathological and prognostic differences between clear cell and non-clear cell renal cell carcinoma with venous tumor thrombus [J]. Journal of Peking University (Health Sciences), 2025, 57(4): 644-649.
[3] Zhanyi ZHANG, Min LU, Yuehao SUN, Jinghan DONG, Xiaofei HOU, Chunlei XIAO, Guoliang WANG, Xiaojun TIAN, Lulin MA, Hongxian ZHANG, Shudong ZHANG. Clinicopathological features and survival analysis of TFE3-rearranged renal cell carcinoma with venous tumor thrombus [J]. Journal of Peking University (Health Sciences), 2025, 57(4): 650-661.
[4] Zezhen ZHOU, Liyuan GE, Fan ZHANG, Shaohui DENG, Ye YAN, Hongxian ZHANG, Guoliang WANG, Lei LIU, Yi HUANG, Shudong ZHANG. A retrospective matching study of partial nephrectomy and radical nephrectomy for pathological T3a stage renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2025, 57(4): 704-710.
[5] Fan SHU,Yichang HAO,Zhanyi ZHANG,Shaohui DENG,Hongxian ZHANG,Lei LIU,Guoliang WANG,Xiaojun TIAN,Lei ZHAO,Lulin MA,Shudong ZHANG. Functional and oncologic outcomes of partial nephrectomy for cystic renal cell carcinoma: A single-center retrospective study [J]. Journal of Peking University (Health Sciences), 2024, 56(4): 667-672.
[6] Zezhen ZHOU,Shaohui DENG,Ye YAN,Fan ZHANG,Yichang HAO,Liyuan GE,Hongxian ZHANG,Guoliang WANG,Shudong ZHANG. Predicting the 3-year tumor-specific survival in patients with T3a non-metastatic renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2024, 56(4): 673-679.
[7] Yun-chong LIU,Zong-long WU,Li-yuan GE,Tan DU,Ya-qian WU,Yi-meng SONG,Cheng LIU,Lu-lin MA. Mechanism of nuclear protein 1 in the resistance to axitinib in clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2023, 55(5): 781-792.
[8] Dong LAN,Zhuo LIU,Yu-xuan LI,Guo-liang WANG,Xiao-jun TIAN,Lu-lin MA,Shu-dong ZHANG,Hong-xian ZHANG. Risk factors for massive hemorrhage after radical nephrectomy and removal of venous tumor thrombus [J]. Journal of Peking University (Health Sciences), 2023, 55(5): 825-832.
[9] Qi SHEN,Yi-xiao LIU,Qun HE. Mucinous tubular and spindle cell carcinoma of kidney: Clinicopathology and prognosis [J]. Journal of Peking University (Health Sciences), 2023, 55(2): 276-282.
[10] Quan ZHANG,Hai-feng SONG,Bing-lei MA,Zhe-nan ZHANG,Chao-hui ZHOU,Ao-lin LI,Jun LIU,Lei LIANG,Shi-yu ZHU,Qian ZHANG. Pre-operative prognostic nutritional index as a predictive factor for prognosis in non-metastatic renal cell carcinoma treated with surgery [J]. Journal of Peking University (Health Sciences), 2023, 55(1): 149-155.
[11] Mei-ni ZUO,Yi-qing DU,Lu-ping YU,Xiang DAI,Tao XU. Correlation between metabolic syndrome and prognosis of patients with clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 636-643.
[12] Tian-yu CAI,Zhen-peng ZHU,Chun-ru XU,Xing JI,Tong-de LV,Zhen-ke GUO,Jian LIN. Expression and significance of fibroblast growth factor receptor 2 in clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 628-635.
[13] Er-shu BO,Peng HONG,Yu ZHANG,Shao-hui DENG,Li-yuan GE,Min LU,Nan LI,Lu-lin MA,Shu-dong ZHANG. Clinicopathological features and prognostic analysis of papillary renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 615-620.
[14] Cai-peng QIN,Yu-xuan SONG,Meng-ting DING,Fei WANG,Jia-xing LIN,Wen-bo YANG,Yi-qing DU,Qing LI,Shi-jun LIU,Tao XU. Establishment of a mutation prediction model for evaluating the efficacy of immunotherapy in renal carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 663-668.
[15] Yu TIAN,Xiao-yue CHENG,Hui-ying HE,Guo-liang WANG,Lu-lin MA. Clinical and pathological features of renal cell carcinoma with urinary tract tumor thrombus: 6 cases report and literature review [J]. Journal of Peking University (Health Sciences), 2021, 53(5): 928-932.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!