Email Alert | RSS

Journal of Peking University (Health Sciences) ›› 2023, Vol. 55 ›› Issue (2): 217-227. doi: 10.19723/j.issn.1671-167X.2023.02.004

Previous Articles     Next Articles

Read-through circular RNA rt-circ-HS promotes hypoxia inducible factor 1α expression and renal carcinoma cell proliferation, migration and invasiveness

Yun-yi XU1,Zheng-zheng SU1,Lin-mao ZHENG1,Meng-ni ZHANG1,Jun-ya TAN1,2,Ya-lan YANG1,Meng-xin ZHANG1,Miao XU1,Ni CHEN1,2,Xue-qin CHEN1,2,Qiao ZHOU1,2,*()   

  1. 1. Department of Pathology, West China Hospital, Sichuan University, Chengdu 610041, China
    2. Research Laboratory of Pathology, West China Hospital, Sichuan University, Chengdu 610041, China
  • Received:2022-11-16 Online:2023-04-18 Published:2023-04-12
  • Contact: Qiao ZHOU E-mail:zhou_qiao@hotmail.com

RICH HTML

   

PDF (PC)

Abstract:

Objective: To identify and characterize read-through RNAs and read-through circular RNAs (rt-circ-HS) derived from transcriptional read-through hypoxia inducible factor 1α (HIF1α) and small nuclear RNA activating complex polypeptide 1 (SNAPC1) the two adjacent genes located on chromosome 14q23, in renal carcinoma cells and renal carcinoma tissues, and to study the effects of rt-circ-HS on biological behavior of renal carcinoma cells and on regulation of HIF1α. Methods: Reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing were used to examine expression of read-through RNAs HIF1α-SNAPC1 and rt-circ-HS in different tumor cells. Tissue microarrays of 437 different types of renal cell carcinoma (RCC) were constructed, and chromogenic in situ hybridization (ISH) was used to investigate expression of rt-circ-HS in different RCC types. Small interference RNA (siRNA) and artificial overexpression plasmids were designed to examine the effects of rt-circ-HS on 786-O and A498 renal carcinoma cell proliferation, migration and invasiveness by cell counting kit 8 (CCK8), EdU incorporation and Transwell cell migration and invasion assays. RT-PCR and Western blot were used to exa-mine expression of HIF1α and SNAPC1 RNA and proteins after interference of rt-circ-HS with siRNA, respectively. The binding of rt-circ-HS with microRNA 539 (miR-539), and miR-539 with HIF1α 3′ untranslated region (3′ UTR), and the effects of these interactions were investigated by dual luciferase reporter gene assays. Results: We discovered a novel 1 144 nt rt-circ-HS, which was derived from read-through RNA HIF1α-SNAPC1 and consisted of HIF1α exon 2-6 and SNAPC1 exon 2-4. Expression of rt-circ-HS was significantly upregulated in 786-O renal carcinoma cells. ISH showed that the overall positive expression rate of rt-circ-HS in RCC tissue samples was 67.5% (295/437), and the expression was different in different types of RCCs. Mechanistically, rt-circ-HS promoted renal carcinoma cell proliferation, migration and invasiveness by functioning as a competitive endogenous inhibitor of miR-539, which we found to be a potent post-transcriptional suppressor of HIF1α, thus promoting expression of HIF1α. Conclusion: The novel rt-circ-HS is highly expressed in different types of RCCs and acts as a competitive endogenous inhibitor of miR-539 to promote expression of its parental gene HIF1α and thus the proliferation, migration and invasion of renal cancer cells.

Key words: Read-through circular RNA HIF1α-SNAPC1, Renal cell carcinoma, Hypoxia inducible factor 1α, Small nuclear RNA activating complex polypeptide 1, microRNA 539

CLC Number: 

  • R365

Table 1

Primer sequence of RT-PCR"

mRNA name Primer sequence(5′-3′) Length/bp
rt-circ-HS
(divergent primer)		 FP：TCACTTTACAGCAATGCCCA
RP：TCCTCACACGCAAATAGCTGA		 306
rt-circ-HS
(convergent primer)		 FP：GTGAACCCATTCCTCACCCA
RP：AGCACCAACTCTGATCTGGA		 209
rt-circ-HS full length
(divergent primer)		 FP：CACTTTACAGCAATGCCCA
RP：TCAGCACCAAGCAGGTCATAGG		 761
rt-circ-HS full length
(convergent primer)		 FP：GGTATAAGAAACCACCTATGAC
RP：CACACGATCACTTGGGTCC		 518
HIF1α FP：GATGTAATGCTCCCCTCACC
RP：ATTCATTGACCATATCACTATCCAC		 295
SNAPC1 FP：CAGGAGACGGACAGTGTACG
RP：TCGCCAAGCCAAAGCTAAAGC		 138
BNIP3 FP：ACCAACAGGGCTTCTGAAAC
RP：GAGGGTGGCCGTGCGC		 202
VEGF FP：AGGAGGGCAGAATCATCACG
RP：GCACACAGGATGGCTTGAAGA		 140
β-actin FP：CTGGCACCACACCTTCTACAATG
RP：CCTCGTAGATGGGCACAGTGTG		 248
U6 FP: TGGAACGATACAGAGAAGATTAGCA
RP：AACGCTTCACGAATTTGCGT
TaqMan probe：FAM-CCCCTGCGCAAGGA-MGB		 75
miR-539 FP: CGGCGGGAGAAATTATCCT
RP：GTGCAGGGTCCGAGGT
TaqMan probe：FAM-ACTGGATACGACACTCCACACCA-MGB		 74

Figure 1

Discovery and characterization of rt-circ-HS A, B, bioinformatics and sequencing analysis identified three novel read-through RNAs derived from HIF1α and SNAPC1, with respective genomic sequence structures; C, structure and sequencing of the novel rt-circ-HS derived from HIF1α-SNAPC1 read-through. The junction site of rt-circ-HS was verified by Sanger sequencing; D, rt-circ-HS full length convergent primers and divergent primers were designed for RT-PCR to characterize the rt-circ-HS derived from HIF1α exon 6-SNAPC1 exon 2 read-through RNA; E, the read-through RNAs of HIF1α exon 10-SNAPC1 exon 2 and HIF1α exon 9-SNAPC1 exon 2 did not form circRNAs. rt-circ-HS, read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; RT-PCR, reverse transcription-polymerase chain reaction; circRNA, circular RNA."

Figure 2

Expression of rt-circ-HS in different cell lines and renal cell carcinoma tissues A, RT-PCR showed that HIF1α exon 6-SNAPC1 exon 2 read-through RNA was present in different renal cancer cells, including A498, ACHN, 786-O, 769-P, OS-RC-2, normal renal epithelial cell HK-2, and human embryonic kidney cell HEK-293. The circular rt-circ-HS was highly expressed in renal cancer cell 786-O, weakly expressed in human embryonic kidney cell HEK-293, and was very low in other cells; B, HIF1α exon 6-SNAPC1 exon 2 read-through RNA, but not the circular rt-circ-HS was found in various cells lines, including prostate cancer cells (PC3, DU45, 22RV1), prostate epithelial cells (RWPE-1), bladder cancer cells (T24), cervical cancer cells (HeLa), glioma cells (U251, U87), astrocytes (HA) and microglia cells (HMC3); C, chromogenic ISH showed high expression of rt-circ-HS in different renal cell carcinoma tissue samples in tissue microarrays, the blue-purple ISH signals indicated the positive signal, and the nuclei were stained green. For each RCC type, low power fields (×40) were shown with insets of high power fields (×400). RT-PCR, reverse transcription-polymerase chain reaction; rt-circ-HS, read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; ISH, in situ hybridization; ccRCC, clear cell renal cell carcinoma; pRCC, papillary renal cell carcinoma; chRCC, chromophobe renal cell carcinoma; TFE3-RCC, TFE3-translocation renal cell carcinoma; FH-RCC, FH-deficient renal cell carcinoma."

Figure 3

Effects of rt-circ-HS on biological behavior of renal carcinoma cells A, CCK-8 assays showed that rt-circ-HS promoted the survival of renal cell carcinoma cells; B, EdU assays demonstrated rt-circ-HS promoted the proli-feration of renal cell carcinoma cells (immunofluorescence ×200), EdU positivily were shown by bar graph (* P < 0.001); C, Transwell cell migration assays demonstrating rt-circ-HS promoted migration of renal cell carcinoma cells (crystal violet staining ×200), the bar graph showed the number of transmembrane cells in each group(* P < 0.001); D, Transwell cell invasion assays showed that rt-circ-HS promoted invasion of renal cell carcinoma cells (crystal violet staining ×200), the bar graph showed the number of transmembrane cells in each group (* P < 0.001). CCK8, cell counting kit 8; EdU, 5-ethynyl-2'-deoxyuridine; rt-circ-HS, read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; si-NC, small interference RNA negative control; si-rt-circ-HS, small interference RNA of rt-circ-HS; rt-circ-HS-OE, overexpression plasmid of rt-circ-HS."

Figure 4

Regulation of parental genes HIF1α and SNAPC1 by interfering rt-circ-HS A, si-RNA were used to knock down rt-circ-HS in 786-O cells, which resulted in downregulation of mRNA expressions of HIF1α, SNAPC1, BNIP3 and VEGF, whereas artificial rt-circ-HS-OE in A498 cells promoted the mRNA expression of HIF1α, SNAPC1, BNIP3 and VEGF; B, Western blot showed that rt-circ-HS promoted the protein expression of HIF1α and SNAPC1. RT-PCR, reverse transcription-polymerase chain reaction; si-RNA, small interference RNA; si-NC, small interference RNA negative control; si-rt-circ-HS, small interference RNA of rt-circ-HS; rt-circ-HS-OE, overexpression of rt-circ-HS; rt-circ-HS: read-through circular RNA HIFα-SNAPC1; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; BNIP3, BCL2 interacting protein 3; VEGF, vascular endothelial growth factor."

Figure 5

Promotion of HIF1α expression through competitive inhibition of miR-539 by rt-circ-HS A, miR-539 binding sequence was present in both the rt-circ-HS junction site and the HIF1α 3′UTR (703-715 nt) by bioinformatics analysis; B, expression of miR-539 (U6 as internal control) was increased and the mRNA of HIF1α was down-regulated (β-actin as internal control) by miR-539 mimic transfection in 786-O cells (** P < 0.01, *** P < 0.001); C, dual luciferase reporter gene assays showing that miR-539 mimics suppressed reporter gene activity of pGL3-circ-HS-WT, but not pGL3-circ-HS-MUT (+, plasmids or mimics added at transfection; -, plasmids or mimics were not added; *** P < 0.001); D, dual luciferase reporter gene assays demonstrating miR-539 mimics suppressed reporter gene activity of wild-type pGL3-HIF1α-WT, but not mutated pGL3-HIF1α-MUT. Simultaneous transfection with pGL3-circ-HS-WT, but not pGL3-circ-HS-MUT, reversed the inhibitory effects of miR-539 mimic on reporter gene activity of pGL3-HIF1α-WT, but not the pGL3-HIF1α-MUT (+, plasmids or mimics added at transfection; -, plasmids or mimics were not added; * P < 0.05, ** P < 0.01); E, schematic summary of the major findings of the present study. RT-PCR, reverse transcription-polymerase chain reaction; Q-PCR, real-time quantitative polymerase chain reaction; rt-circ-HS, read-through circular RNA HIFα-SNAPC1; miR-539, micro RNA 539; 3′ UTR, 3′ untranslated region; HIF1α, hypoxia inducible factor 1α; SNAPC1, small nuclear RNA activating complex polypeptide 1; BNIP3, BCL2 interacting protein 3; VEGF, vascular endothelial growth factor; U6, U6 small nuclear RNA; WT, wild type; MUT, mutation."

1 Zhou WY , Cai ZR , Liu J , et al. Circular RNA: Metabolism, functions and interactions with proteins[J]. Mol Cancer, 2020, 19 (1): 172.
doi: 10.1186/s12943-020-01286-3
2 Chen Q , Liu T , Bao Y , et al. CircRNA cRAPGEF5 inhibits the growth and metastasis of renal cell carcinoma via the miR-27a-3p/TXNIP pathway[J]. Cancer Lett, 2020, 469, 68- 77.
doi: 10.1016/j.canlet.2019.10.017
3 Mao W , Wang K , Xu B , et al. ciRS-7 is a prognostic biomarker and potential gene therapy target for renal cell carcinoma[J]. Mol Cancer, 2021, 20 (1): 142- 155.
doi: 10.1186/s12943-021-01443-2
4 van Zonneveld AJ , Kolling M , Bijkerk R , et al. Circular RNAs in kidney disease and cancer[J]. Nat Rev Nephrol, 2021, 17 (12): 814- 826.
doi: 10.1038/s41581-021-00465-9
5 Zhang Y , Gong M , Yuan H , et al. Chimeric transcript generated by cis-splicing of adjacent genes regulates prostate cancer cell proliferation[J]. Cancer Discov, 2012, 2 (7): 598- 607.
doi: 10.1158/2159-8290.CD-12-0042
6 Grosso AR , Leite AP , Carvalho S , et al. Pervasive transcription read-through promotes aberrant expression of oncogenes and RNA chimeras in renal carcinoma[J]. Elife, 2015, 4, e09214.
doi: 10.7554/eLife.09214
7 Pflueger D , Mittmann C , Dehler S , et al. Functional characterization of BC039389-GATM and KLK4-KRSP1 chimeric read-through transcripts which are up-regulated in renal cell cancer[J]. BMC Genomics, 2015, 16 (1): 247.
doi: 10.1186/s12864-015-1446-z
8 Chen N , Zhou Q . Constructing tissue microarrays without prefabricating recipient blocks: A novel approach[J]. Am J Clin Pathol, 2005, 124 (1): 103- 107.
doi: 10.1309/LHCJRFBUH8Q6QD3N
9 Turajlic S , Swanton C , Boshoff C . Kidney cancer: The next decade[J]. J Exp Med, 2018, 215 (10): 2477- 2479.
doi: 10.1084/jem.20181617
10 Siegel RL , Miller KD , Fuchs HE , et al. Cancer statistics 2022[J]. CA Cancer J Clin, 2022, 72 (1): 7- 33.
doi: 10.3322/caac.21708
11 Garje R , Elhag D , Yasin HA , et al. Comprehensive review of chromophobe renal cell carcinoma[J]. Crit Rev Oncol Hematol, 2021, 160, 103287.
doi: 10.1016/j.critrevonc.2021.103287
12 Ji SQ , Su XL , Cheng WL , et al. Down-regulation of CD74 inhi-bits growth and invasion in clear cell renal cell carcinoma through HIF-1α pathway[J]. Urol Oncol, 2014, 32 (2): 153- 161.
doi: 10.1016/j.urolonc.2012.09.013
13 Hu CJ , Wang LY , Chodosh LA , et al. Differential roles of hypo-xia-inducible factor 1alpha (HIF-1alpha) and HIF-2alpha in hypoxic gene regulation[J]. Mol Cell Biol, 2003, 23 (24): 9361- 9374.
doi: 10.1128/MCB.23.24.9361-9374.2003
14 Shen C , Beroukhim R , Schumacher SE , et al. Genetic and functional studies implicate HIF1alpha as a 14q kidney cancer suppressor gene[J]. Cancer Discov, 2011, 1 (3): 222- 235.
doi: 10.1158/2159-8290.CD-11-0098
15 Shinojima T , Oya M , Takayanagi A , et al. Renal cancer cells lacking hypoxia inducible factor (HIF)-1alpha expression maintain vascular endothelial growth factor expression through HIF-2alpha[J]. Carcinogenesis, 2007, 28 (3): 529- 536.
16 Swiatek M , Jancewicz I , Kluebsoongnoen J , et al. Various forms of HIF-1alpha protein characterize the clear cell renal cell carcinoma cell lines[J]. IUBMB Life, 2020, 72 (6): 1220- 1232.
doi: 10.1002/iub.2281
17 Vidal AF . Read-through circular RNAs reveal the plasticity of RNA processing mechanisms in human cells[J]. RNA Biol, 2020, 17 (12): 1823- 1826.
doi: 10.1080/15476286.2020.1805233
18 Yang X , Ye T , Liu H , et al. Expression profiles, biological functions and clinical significance of circRNAs in bladder cancer[J]. Mol Cancer, 2021, 20 (1): 4.
doi: 10.1186/s12943-020-01300-8
19 Wu X , Zhou J , Zhao L , et al. CircCYP24A1 hampered malignant phenotype of renal cancer carcinoma through modulating CMTM-4 expression via sponging miR-421[J]. Cell Death Dis, 2022, 13 (2): 190.
doi: 10.1038/s41419-022-04623-0
20 Wang X , Xing L , Yang R , et al. The circACTN4 interacts with FUBP1 to promote tumorigenesis and progression of breast cancer by regulating the expression of proto-oncogene MYC[J]. Mol Cancer, 2021, 20 (1): 91.
doi: 10.1186/s12943-021-01383-x
21 Abdelmohsen K , Panda AC , Munk R , et al. Identification of HuR target circular RNAs uncovers suppression of PABPN1 translation by CircPABPN1[J]. RNA Biol, 2017, 14 (3): 361- 369.
doi: 10.1080/15476286.2017.1279788
22 Khan FA , Nsengimana B , Khan NH , et al. Chimeric peptides/proteins encoded by circRNA: An update on mechanisms and functions in human cancers[J]. Front Oncol, 2022, 12, 781270.
doi: 10.3389/fonc.2022.781270
23 Pintarelli G , Dassano A , Cotroneo CE , et al. Read-through transcripts in normal human lung parenchyma are down-regulated in lung adenocarcinoma[J]. Oncotarget, 2016, 7 (19): 27889- 27898.
doi: 10.18632/oncotarget.8556
24 Choi ES , Lee H , Lee CH , et al. Overexpression of KLHL23 protein from read-through transcription of PHOSPHO2-KLHL23 in gastric cancer increases cell proliferation[J]. FEBS Open Bio, 2016, 6 (11): 1155- 1164.
doi: 10.1002/2211-5463.12136
25 Wang L , Xiong X , Yao Z , et al. Chimeric RNA ASTN2-PAPPA(as) aggravates tumor progression and metastasis in human esophageal cancer[J]. Cancer Lett, 2021, 501, 1- 11.
doi: 10.1016/j.canlet.2020.10.052
26 Qin F , Zhang Y , Liu J , et al. SLC45A3-ELK4 functions as a long non-coding chimeric RNA[J]. Cancer Lett, 2017, 404, 53- 61.
doi: 10.1016/j.canlet.2017.07.007
[1] Fan SHU, Liyuan GE, Hanzhang DENG, Haoming YIN, Junyong OU, Shaohui DENG, Yichang HAO, Min LU, Zhanyi ZHANG, Peichen DUAN, Shudong ZHANG. Molecular characteristics for poor prognosis related renal cell carcinoma with lymph metastases [J]. Journal of Peking University (Health Sciences), 2026, 58(3): 631-640.
[2] Haoming YIN, Zijie WANG, Fan SHU, Zhanyi ZHANG, Hui LIANG, Shudong ZHANG. Expression and significance of the FABP6 long transcript in clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2026, 58(2): 393-398.
[3] Boda GUO, Min LU, Guoliang WANG, Hongxian ZHANG, Lei LIU, Xiaofei HOU, Lei ZHAO, Xiaojun TIAN, Shudong ZHANG. Clinicopathological and prognostic differences between clear cell and non-clear cell renal cell carcinoma with venous tumor thrombus [J]. Journal of Peking University (Health Sciences), 2025, 57(4): 644-649.
[4] Zhanyi ZHANG, Min LU, Yuehao SUN, Jinghan DONG, Xiaofei HOU, Chunlei XIAO, Guoliang WANG, Xiaojun TIAN, Lulin MA, Hongxian ZHANG, Shudong ZHANG. Clinicopathological features and survival analysis of TFE3-rearranged renal cell carcinoma with venous tumor thrombus [J]. Journal of Peking University (Health Sciences), 2025, 57(4): 650-661.
[5] Zezhen ZHOU, Liyuan GE, Fan ZHANG, Shaohui DENG, Ye YAN, Hongxian ZHANG, Guoliang WANG, Lei LIU, Yi HUANG, Shudong ZHANG. A retrospective matching study of partial nephrectomy and radical nephrectomy for pathological T3a stage renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2025, 57(4): 704-710.
[6] Fan SHU,Yichang HAO,Zhanyi ZHANG,Shaohui DENG,Hongxian ZHANG,Lei LIU,Guoliang WANG,Xiaojun TIAN,Lei ZHAO,Lulin MA,Shudong ZHANG. Functional and oncologic outcomes of partial nephrectomy for cystic renal cell carcinoma: A single-center retrospective study [J]. Journal of Peking University (Health Sciences), 2024, 56(4): 667-672.
[7] Zezhen ZHOU,Shaohui DENG,Ye YAN,Fan ZHANG,Yichang HAO,Liyuan GE,Hongxian ZHANG,Guoliang WANG,Shudong ZHANG. Predicting the 3-year tumor-specific survival in patients with T3a non-metastatic renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2024, 56(4): 673-679.
[8] Yun-chong LIU,Zong-long WU,Li-yuan GE,Tan DU,Ya-qian WU,Yi-meng SONG,Cheng LIU,Lu-lin MA. Mechanism of nuclear protein 1 in the resistance to axitinib in clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2023, 55(5): 781-792.
[9] Dong LAN,Zhuo LIU,Yu-xuan LI,Guo-liang WANG,Xiao-jun TIAN,Lu-lin MA,Shu-dong ZHANG,Hong-xian ZHANG. Risk factors for massive hemorrhage after radical nephrectomy and removal of venous tumor thrombus [J]. Journal of Peking University (Health Sciences), 2023, 55(5): 825-832.
[10] Qi SHEN,Yi-xiao LIU,Qun HE. Mucinous tubular and spindle cell carcinoma of kidney: Clinicopathology and prognosis [J]. Journal of Peking University (Health Sciences), 2023, 55(2): 276-282.
[11] Quan ZHANG,Hai-feng SONG,Bing-lei MA,Zhe-nan ZHANG,Chao-hui ZHOU,Ao-lin LI,Jun LIU,Lei LIANG,Shi-yu ZHU,Qian ZHANG. Pre-operative prognostic nutritional index as a predictive factor for prognosis in non-metastatic renal cell carcinoma treated with surgery [J]. Journal of Peking University (Health Sciences), 2023, 55(1): 149-155.
[12] Mei-ni ZUO,Yi-qing DU,Lu-ping YU,Xiang DAI,Tao XU. Correlation between metabolic syndrome and prognosis of patients with clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 636-643.
[13] Tian-yu CAI,Zhen-peng ZHU,Chun-ru XU,Xing JI,Tong-de LV,Zhen-ke GUO,Jian LIN. Expression and significance of fibroblast growth factor receptor 2 in clear cell renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 628-635.
[14] Er-shu BO,Peng HONG,Yu ZHANG,Shao-hui DENG,Li-yuan GE,Min LU,Nan LI,Lu-lin MA,Shu-dong ZHANG. Clinicopathological features and prognostic analysis of papillary renal cell carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 615-620.
[15] Cai-peng QIN,Yu-xuan SONG,Meng-ting DING,Fei WANG,Jia-xing LIN,Wen-bo YANG,Yi-qing DU,Qing LI,Shi-jun LIU,Tao XU. Establishment of a mutation prediction model for evaluating the efficacy of immunotherapy in renal carcinoma [J]. Journal of Peking University (Health Sciences), 2022, 54(4): 663-668.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
Copyright © Journal of Peking University (Health Sciences), All Rights Reserved.
Powered by Beijing Magtech Co. Ltd