Journal of Peking University (Health Sciences) ›› 2023, Vol. 55 ›› Issue (4): 689-696. doi: 10.19723/j.issn.1671-167X.2023.04.020

Previous Articles     Next Articles

Characteristics and microRNA expression profile of exosomes derived from odontogenic dental pulp stem cells

Yu-yang YE,Lin YUE,Xiao-ying ZOU*(),Xiao-yan WANG*()   

  1. Department of Cariology and Endodontology, Peking University School and Hospital of Stomatology & National Center for Stomatology & National Clinical Research Center for Oral Diseases & National Engineering Research Center of Oral Biomaterials and Digital Medical Devices & Beijing Key Laboratory of Digital Stomatology & NHC Research Center of Engineering and Technology for Computerized Dentistry & NMPA Key Laboratory for Dental Materials, Beijing 100081, China
  • Received:2020-10-10 Online:2023-08-18 Published:2023-08-03
  • Contact: Xiao-ying ZOU,Xiao-yan WANG E-mail:zouxiaoying1125@163.com;wangxiaoyanpx@163.com

RICH HTML

  

Abstract:

Objective: To investigate the characteristics of exosomes derived from dental pulp stem cells (DPSCs) in the direction of odontogenic differentiation, to analyze the differences in microRNA expression profile between exosomes derived from undifferentiated and odontogenic DPSCs, and to analyze their possible signal transduction pathways. Methods: (1) DPSCs were cultured in α minimum Eagle' s medium (α-MEM), and odontogenic DPSCs were cultured in odontogenic differentiation medium for 21 days, using alizarin red staining and alkaline phosphatase staining to identify the odontogenic differentiation. Exosomes from the cell supernatant were isolated respectively, named as dental pulp stem cells-exosomes (DPSCs-Exo) and dental pulp stem cells-odontogenic-exosomes (DPSCs-OD-Exo). The exosomes were identified by transmission electron microscopy, nanoparticle tracking analysis and Western blot. (2) The microRNA expression profiles of DPSCs-Exo and DPSCs-OD-Exo were investigated by microRNA microarray. To validate the result of the microRNA microarray, real-time quantitative polymerase chain reaction (real-time PCR) assay was applied on 3 most significantly differential expressed microRNA. Pathway analysis was taken to detect enriched pathways associated with the predicted target genes of microRNA. Results: (1) The DPSCs were isolated and cultured in vitro showed typical fibroblast-like morphology. The odontogenic differentiated DPSCs were spindle-shaped, polygonal, and uniform in size. Odontogenic differentiation group showed a large number of dark deposits in alizarin red staining and the cells were darkly stained in alkaline phosphatase staining, while the cells in normal culture medium group did not show obvious dyeing. The DPSCs-Exo and DPSCs-OD-Exo had the same morphology, both showed bilayer membrane and cup-shape. The peak sizes of DPSCs-Exo and DPSCs-OD-Exo were (114.67±9.07) nm and (134.00±8.54) nm, respectively. The difference between the two was statistically significant. DPSCs-Exo and DPSCs-OD-Exo both expressed the markers of exosomes, tumor susceptibility gene (TSG)101 and CD63. (2) microRNA microarray results showed that the expression profiles of DPSCs-Exo and DPSCs-OD-Exo were different. Nineteen increased by more than two times, and one decreased by 64%. Real-time PCR results showed that the expression levels of microRNA-1246, microRNA-1246-100-5p and microRNA-1246-494-3p in DPSCs-OD-Exo were significantly up-regulated. The difference was statistically significant. microRNA target prediction database and gene signaling pathway database were used to analyze differentially expressed microRNA, and it was predicted that differentially expressed microRNA could target axis inhibition protein 2(AXIN2) gene and Wnt/β-catenin signaling pathway. Conclusion: DPSCs-OD-Exo and DPSCs-Exo had differences in their microRNA expression profile. Those differentially expressed microRNA may be involved in the regulation of DPSCs odontogenic differentiation.

Key words: Dental pulp stem cells, Exosomes, microRNA

CLC Number: 

  • R781.3

Table 1

microRNA reverse transcription primers"

GenesReverse transcription primers
microRNA-100-5p5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACAAG3′
microRNA-12465′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCCTGCT3′
microRNA-494-3p5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGAGGTT3′
microRNA-191-5p5′GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAGCTG3′

Table 2

microRNA bidirectional primers"

GenesBidirectional primersAnnealing temperature/℃Base pair/bp
microRNA-100-5pGSP: 5′GCAACCCGTAGATCCGAA3′
R: 5′CAGTGCGTGTCGTGGAGT3′
6062
microRNA-1246GSP: 5′GGGGAATGGATTTTTGG3′
R: 5′CAGTGCGTGTCGTGGAG3′
6063
microRNA-494-3pGSP: 5′GGGGTGAAACATACACGGGA3′
R: 5′GTGCGTGTCGTGGAGTCG3′
6064
microRNA-191-5pGSP: 5′GGCAACGGAATCCCAAAAG3′
R: 5′GTGCGTGTCGTGGAGTCG3′
6063

Figure 1

Morphology and differentiation identification results of undifferentiated and odontogenic DPSCs A, B, bright view of undifferentiated and odontogenic DPSCs cultured for 3 weeks; C, D, alizarin red staining results of undifferentiated and odontoge-nic DPSCs; E, F, alkaline phosphatase staining results of undifferentiated and odontogenic DPSCs. DPSCs, dental pulp stem cells."

Figure 2

Identification of DPSCs-Exo and DPSCs-OD-Exo A, B, DPSCs-Exo and DPSCs-OD-Exo exosomes morphology under transmission electron microscope; C, Western blot detects the expression of exosomal markers in DPSCs-Exo and DPSCs-OD-Exo; D, E, NTA results of DPSCs-Exo and DPSCs-OD-Exo. DPSCs-Exo, dental pulp stem cells-exosomes; DPSCs-OD-Exo, dental pulp stem cells-odontogenic-exosomes; TSG101, tumor susceptibility gene 101; NTA, nanoparti-cletracking analysis."

Table 3

Differential expressed microRNA in DPSCs-OD-Exo and DPSCs-Exo"

microRNAIncrease/decreaseFoldP
microRNA-100-5pIncrease2.16< 0.01
microRNA-1246Increase84.65< 0.01
microRNA-1587Increase2.03< 0.01
microRNA-3136-5pIncrease2.27< 0.01
microRNA-3912-5pIncrease2.69< 0.01
microRNA-3923Increase2.38< 0.01
microRNA-3945Increase2.31< 0.01
microRNA-4259Increase2.18< 0.01
microRNA-4707-5pIncrease2.15< 0.01
microRNA-4754Increase2.00< 0.01
microRNA-494-3pIncrease2.82< 0.01
microRNA-5196-5pIncrease2.18< 0.01
microRNA-5687Increase2.37< 0.01
microRNA-588Increase2.25< 0.01
microRNA-6133Increase2.35< 0.01
microRNA-6779-5pIncrease2.00< 0.01
microRNA-6813-5pIncrease2.10< 0.01
microRNA-6823-5pIncrease2.30< 0.01
microRNA-6832-5pIncrease2.21< 0.01
microRNA-1-3pDecrease2.19< 0.01

Figure 3

DPSCs-Exo and DPSCs-OD-Exo microRNA heat map microRNA levels in DPSCs-OD-Exo significantly changed when compared with that in DPSCs-Exo, the green to red corresponds to the gene expression level from low to high. DPSCs-Exo, dental pulp stem cells-exosomes; DPSCs-OD-Exo, dental pulp stem cells-odontogenic-exosomes."

Figure 4

microRNA-1246 was used as an example to predict target genes from the database miRTarBase, miRDB, miRWalk databases were used to predict micro-RNA-1246 target genes to make a Venn diagram."

1 GongQ,WangR,JiangH,et al.Alteration of microRNA expression of human dental pulp cells during odontogenic differentiation[J].JOE,2012,38(10):1348-1354.
2 TheryC,ZitvogelL,AmigorenaS.Exosomes: Composition, biogenesis and function[J].Nat Rev Immunol,2002,2(8):569-579.
doi: 10.1038/nri855
3 van RooijE.The art of microRNA research[J].Circ Res,2011,108(2):219-234.
doi: 10.1161/CIRCRESAHA.110.227496
4 CuiY,LuanJ,LiH,et al.Exosomes derived from mineralizing osteoblasts promote ST2 cell osteogenic differentiation by alteration of microRNA expression[J].Febs Lett,2016,590(1):185-192.
doi: 10.1002/1873-3468.12024
5 刘敬一,邹晓英,陈雪,等.脂多糖对人根尖牙乳头干细胞中基质细胞衍生因子1表达的影响[J].中华口腔医学杂志,2015,50(6):346-351.
6 NarayananK,KumarS,PadmanabhanP,et al.Lineage-specific exosomes could override extracellular matrix mediated human mesenchymal stem cell differentiation[J].Biomaterials,2018,182(9):312-322.
7 LotvallJ,HillAF,HochbergF,et al.Minimal experimental requirements for definition of extracellular vesicles and their functions: A position statement from the International Society for Extracellular Vesicles[J].J Extracell Vesicles,2014,3(3):13-18.
8 HuX,ZhongY,KongY,et al.Lineage-specific exosomes promote the odontogenic differentiation of human dental pulp stem cells (DPSCs) through TGFβ1/smads signaling pathway via transfer of microRNAs[J].Stem Cell Res Ther,2019,10(1):170-184.
doi: 10.1186/s13287-019-1278-x
9 WangJ,LiuB,GuS,et al.Effects of Wnt/β-catenin signalling on proliferation and differentiation of apical papilla stem cells[J].Cell Prolif,2012,45(2):121-131.
doi: 10.1111/j.1365-2184.2012.00806.x
10 ChenD,SunY,YuanY,et al.miR-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion[J].PLoS Genet,2014,10(2):57-58.
11 LuY,ZhaoX,LiuQ,et al.lncRNA Mir100HG-derived miR-100 and miR-125b mediate cetuximab resistance via Wnt/β-catenin signaling[J].Nat Med,2017,23(11):1331-1341.
doi: 10.1038/nm.4424
12 YuanW,WangD,LiuY,et al.miR-494 inhibits cell proliferation and metastasis via targeting of CDK6 in osteosarcoma[J].Mol Med Rep,2017,16(6):8627-8634.
doi: 10.3892/mmr.2017.7709
13 ZhangJ,ZhuY,HuL,et al.miR-494 induces EndMT and promotes the development of HCC (hepatocellular carcinoma) by targeting SIRT3/TGF-β/SMAD signaling pathway[J].Sci Rep,2019,9(1):7213-7225.
doi: 10.1038/s41598-019-43731-4
14 NakamuraT,IwamotoT,NakamuraHM,et al.Regulation of miR-1 mediated connexin 43 expression and cell proliferation in dental epithelial cells[J].Front Cell Dev Biol,2020,8(1):156-157.
15 ChaiS,NgKY,TongM,et al.Octamer 4/microRNA-1246 signaling axis drives Wnt/beta-catenin activation in liver cancer stem cells[J].Hepatology,2016,64(6):2062-2076.
doi: 10.1002/hep.28821
16 KatohM.WNT signaling pathway and stem cell signaling network[J].Clin Cancer Res,2007,13(14):4042-4045.
doi: 10.1158/1078-0432.CCR-06-2316
17 ChenJ,LanY,BaekJA,et al.Wnt/beta-catenin signaling plays an essential role in activation of odontogenic mesenchyme during early tooth development[J].Dev Biol,2009,334(1):174-185.
doi: 10.1016/j.ydbio.2009.07.015
18 TaoK,XiaoD,WengJ,et al.Berberine promotes bone marrow-derived mesenchymal stem cells osteogenic differentiation via canonical Wnt/β-catenin signaling pathway[J].Toxicol Lett,2016,240(1):68-80.
doi: 10.1016/j.toxlet.2015.10.007
[1] Ruofan GAO, Tianyu MA, Runkai WANG, Yuchen YIN, Ruidi LI, Dandan WANG, Bin XIA. Anti-inflammatory effects of cell membrane vesicle-mediated delivery of small interfering RNA targeting tumor necrosis factor-α on dental pulp stem cells [J]. Journal of Peking University (Health Sciences), 2026, 58(1): 22-29.
[2] Congyi YANG, Xiaowen ZHENG, Jingyi CHEN, Jun XU, Feng CHEN, Yang CHEN, Ning CHEN. Protein biomarker screening and functional analysis of salivary exosomes in patients with ulcerative colitis [J]. Journal of Peking University (Health Sciences), 2025, 57(5): 895-902.
[3] Chunhui SHENG, Xiao ZHANG, Longwei LV, Yongsheng ZHOU. Exosome derived from human adipose-derived mesenchymal stem cells prevented bone loss induced by estrogen deficiency [J]. Journal of Peking University (Health Sciences), 2025, 57(2): 217-226.
[4] Wen-gen LI,Xiao-dong GU,Rui-qiang WENG,Su-dong LIU,Chao CHEN. Expression and clinical significance of plasma exosomal miR-34-5p and miR-142-3p in systemic sclerosis [J]. Journal of Peking University (Health Sciences), 2023, 55(6): 1022-1027.
[5] Yun-yi XU,Zheng-zheng SU,Lin-mao ZHENG,Meng-ni ZHANG,Jun-ya TAN,Ya-lan YANG,Meng-xin ZHANG,Miao XU,Ni CHEN,Xue-qin CHEN,Qiao ZHOU. Read-through circular RNA rt-circ-HS promotes hypoxia inducible factor 1α expression and renal carcinoma cell proliferation, migration and invasiveness [J]. Journal of Peking University (Health Sciences), 2023, 55(2): 217-227.
[6] PANG Yong,ZHANG Sha,YANG Hua,ZHOU Rou-li. Serum LAPTM4B-35 protein as a novel diagnostic marker for hepatocellular carcinoma [J]. Journal of Peking University (Health Sciences), 2021, 53(4): 710-715.
[7] Xiao WANG,Dan HE,Wen-ting LI,SIYITI Adila·,Rui HAN,Ying DONG. Characteristic and clinical significance of microRNA expression between 144 Uygur and Han women with endometrial carcinoma [J]. Journal of Peking University (Health Sciences), 2020, 52(3): 570-577.
[8] Xiao-min GAO,Xiao-ying ZOU,Lin YUE. Mediated pathways of exosomes uptake by stem cells of apical papilla [J]. Journal of Peking University(Health Sciences), 2020, 52(1): 43-50.
[9] Jing XIE,Yu-ming ZHAO,Nan-quan RAO,Xiao-tong WANG,Teng-jiao-zi FANG,Xiao-xia LI,Yue ZHAI,Jing-zhi LI,Li-hong GE,Yuan-yuan WANG. Comparative study of differentiation potential of mesenchymal stem cells derived from orofacial system into vascular endothelial cells [J]. Journal of Peking University(Health Sciences), 2019, 51(5): 900-906.
[10] Jing ZHANG,Su-fang LI,Hong CHEN,Jun-xian SONG. Role of miR-106b-5p in the regulation of gene profiles in endothelial cells [J]. Journal of Peking University(Health Sciences), 2019, 51(2): 221-227.
[11] KANG Lei, HUO Yan, WANG Rong-fu, ZHANG Chun-li, YAN Ping, XU Xiao-jie. In vivo imaging of breast tumors by a 99mTc radiolabeled probe targeting microRNA-155 in mice models [J]. Journal of Peking University(Health Sciences), 2018, 50(2): 326-330.
[12] JIA Wei-qian, ZHAO Yu-ming, GE Li-hong. Recombinant human transforming growth factor β1 promotes dental pulp stem cells proliferation and mineralization [J]. Journal of Peking University(Health Sciences), 2017, 49(4): 680-681.
[13] CAI Yi, GUO Hao, LI Han-zhong, WANG Wen-da, ZHANG Yu-shi. MicroRNA differential expression profile in tuberous sclerosis complex cell line TSC2-/- MEFs and normal cell line TSC2+/+ MEFs [J]. Journal of Peking University(Health Sciences), 2017, 49(4): 580-584.
[14] XIAO Yang, DU Yao-yao, GAO Cheng, KONG Wei. Dynamic alteration of microRNA in high phosphorus induced calcification of vascular smooth muscle cell [J]. Journal of Peking University(Health Sciences), 2016, 48(5): 756-765.
[15] JIA Ling-fei, GAN Ye-hua, YU Guang-yan. Relationships between microRNA expressions and prognosis in patients with tongue squamous cell carcinoma and the mechanisms microRNA regulating tongue squamous cell carcinoma biological behavior [J]. Journal of Peking University(Health Sciences), 2016, 48(1): 5-9.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!